Molecule Information

General Information of the Molecule (ID: Mol01744)

• Name: hsa-miR-1236-3p ,Homo sapiens
• Synonyms: microRNA 1236
• Molecule Type: Mature miRNA
• Sequence: CCUCUUCCCCUUGUCUCUCCAG
• Ensembl ID: ENSG00000284446
• HGNC ID: HGNC:33925
• Mature Accession: MIMAT0005591

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [ICD-11: 2C25.5] [1]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell colony; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: pim-3 signaling pathway; Inhibition; hsa05206
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: PR-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Upregulation of miR-1236-3p could reverse DDP resistance in lung cancer cells through targeting TPT1 and inhibition of the Pim-3 signaling pathway.

References

• Ref 1: microRNA-1236-3p Regulates DDP Resistance in Lung Cancer Cells. Open Med (Wars). 2019 Jan 16;14:41-51. doi: 10.1515/med-2019-0007. eCollection 2018.