Molecule Information
General Information of the Molecule (ID: Mol01744)
Name |
hsa-miR-1236-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 1236
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
CCUCUUCCCCUUGUCUCUCCAG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung cancer | [1] | |||
Resistant Disease | Lung cancer [ICD-11: 2C25.5] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell colony | Inhibition | hsa05200 | ||
Cell proliferation | Inhibition | hsa05200 | ||
Cell viability | Inhibition | hsa05200 | ||
pim-3 signaling pathway | Inhibition | hsa05206 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
Experiment for Molecule Alteration |
PR-qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | Upregulation of miR-1236-3p could reverse DDP resistance in lung cancer cells through targeting TPT1 and inhibition of the Pim-3 signaling pathway. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.