Molecule Information
General Information of the Molecule (ID: Mol01742)
Name |
hsa-miR-216b-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 216b
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
AAAUCUCUGCAGGCAAAUGUGA
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Prostate cancer | [1] | |||
Resistant Disease | Prostate cancer [ICD-11: 2C82.0] | |||
Resistant Drug | Paclitaxel | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | DU-145 cells | Prostate | Homo sapiens (Human) | CVCL_0105 |
LNCaP cells | Prostate | Homo sapiens (Human) | CVCL_0395 | |
PC3 cells | Prostate | Homo sapiens (Human) | CVCL_0035 | |
RWPE-1 cells | Prostate | Homo sapiens (Human) | CVCL_3791 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Long non-coding RNA Linc00518 Can enhance GATA6 expression by suppressing miR-216b-5p expression to promotes paclitaxel resistance in the human prostate cancer. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.