General Information of the Molecule (ID: Mol01737)
Name
hsa-miR-876-3p ,Homo sapiens
Synonyms
microRNA 876
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGGUGGUUUACAAAGUAAUUCA
    Click to Show/Hide
Ensembl ID
ENSG00000215966
HGNC ID
HGNC:33653
Mature Accession
MIMAT0004925
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell colony Activation hsa05200
Cell viability Activation hsa05200
In Vitro Model BGC-823 cells Gastric Homo sapiens (Human) CVCL_3360
MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
AGS cells Gastric Homo sapiens (Human) CVCL_0139
HGC27 cells Gastric Homo sapiens (Human) CVCL_1279
NCI-N87 cells Gastric Homo sapiens (Human) CVCL_1603
MkN-45 cells Gastric Homo sapiens (Human) CVCL_0434
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CCK8 assay; Colony formation assay
Mechanism Description Si-TMED3 completely inhibited miR-876-3p inhibitor-stimulated enhancement in cisplatin resistance of cisplatin-resistant GC cells.
References
Ref 1 MiR-876-3p regulates cisplatin resistance and stem cell-like properties of gastric cancer cells by targeting TMED3. J Gastroenterol Hepatol. 2019 Oct;34(10):1711-1719. doi: 10.1111/jgh.14649. Epub 2019 Apr 2.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.