Molecule Information

General Information of the Molecule (ID: Mol01737)

• Name: hsa-miR-876-3p ,Homo sapiens
• Synonyms: microRNA 876
• Molecule Type: Mature miRNA
• Sequence: UGGUGGUUUACAAAGUAAUUCA
• Ensembl ID: ENSG00000215966
• HGNC ID: HGNC:33653
• Mature Accession: MIMAT0004925

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell colony; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: CCK8 assay; Colony formation assay
• Mechanism Description: Si-TMED3 completely inhibited miR-876-3p inhibitor-stimulated enhancement in cisplatin resistance of cisplatin-resistant GC cells.

References

• Ref 1: MiR-876-3p regulates cisplatin resistance and stem cell-like properties of gastric cancer cells by targeting TMED3. J Gastroenterol Hepatol. 2019 Oct;34(10):1711-1719. doi: 10.1111/jgh.14649. Epub 2019 Apr 2.