Molecule Information
General Information of the Molecule (ID: Mol01737)
| Name |
hsa-miR-876-3p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 876
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UGGUGGUUUACAAAGUAAUUCA
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [1] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell colony | Activation | hsa05200 | |
| Cell viability | Activation | hsa05200 | ||
| In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
| MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 | |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| AGS cells | Gastric | Homo sapiens (Human) | CVCL_0139 | |
| HGC27 cells | Gastric | Homo sapiens (Human) | CVCL_1279 | |
| NCI-N87 cells | Gastric | Homo sapiens (Human) | CVCL_1603 | |
| MkN-45 cells | Gastric | Homo sapiens (Human) | CVCL_0434 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Colony formation assay | |||
| Mechanism Description | Si-TMED3 completely inhibited miR-876-3p inhibitor-stimulated enhancement in cisplatin resistance of cisplatin-resistant GC cells. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
