Molecule Information

General Information of the Molecule (ID: Mol01732)

• Name: hsa-miR-33b-3p ,Homo sapiens
• Synonyms: microRNA 33b
• Molecule Type: Mature miRNA
• Sequence: CAGUGCCUCGGCAGUGCAGCCC
• Ensembl ID: ENSG00000207839
• HGNC ID: HGNC:32791
• Mature Accession: MIMAT0004811

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [ICD-11: 2C25.5] [1]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: NER signaling pathway; Regulation; N.A.
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Alamar blue assay; EdU cell proliferation assay
• Mechanism Description: miR-33-3b-3p exerted a critical role in modulating the cisplatin sensitivity of lung cancer cells, which might probably through suppressing the p21 expression.

References

• Ref 1: DNA damage responsive miR-33b-3p promoted lung cancer cells survival and cisplatin resistance by targeting p21(WAF1/CIP1). Cell Cycle. 2016 Nov;15(21):2920-2930. doi: 10.1080/15384101.2016.1224043. Epub 2016 Aug 25.