Molecule Information
General Information of the Molecule (ID: Mol01730)
| Name |
hsa-miR-625-3p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 625
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
GACUAUAGAACUUUCCCCCUCA
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal adenocarcinoma [ICD-11: 2B91.2] | [1] | |||
| Resistant Disease | Colorectal adenocarcinoma [ICD-11: 2B91.2] | |||
| Resistant Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| p38/MAPK signaling pathway | Inhibition | hsa04010 | ||
| In Vitro Model | HEK293 Flp pFRT/eGFP cells | Kidney | Homo sapiens (Human) | CVCL_U427 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Inactivation of MAP2k6-p38 signalling as one likely mechanism of oxaliplatin resistance, and miR-625-3p induces oxaliplatin resistance by abrogating MAP2k6-p38-regulated apoptosis and cell cycle control networks. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
