Molecule Information
General Information of the Molecule (ID: Mol01723)
| Name |
hsa-miR-501-3p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 501
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
AAUGCACCCGGGCAAGGAUUCU
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioma | [1] | |||
| Sensitive Disease | Glioma [ICD-11: 2A00.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell viability | Inhibition | hsa05200 | ||
| In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR-501-3p sensitizes glioma cells to cisplatin via reducing protein levels of MYCN. | |||
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.
