Molecule Information
General Information of the Molecule (ID: Mol01722)
Name |
hsa-miR-488-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 488
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UUGAAAGGCUAUUUCUUGGUC
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Melanoma | [1] | |||
Sensitive Disease | Melanoma [ICD-11: 2C30.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | A375 cells | Skin | Homo sapiens (Human) | CVCL_0132 |
Sk-Mel28 cells | Skin | Homo sapiens (Human) | CVCL_0526 | |
B16 cells | Skin | Homo sapiens (Human) | CVCL_F936 | |
HEMn-LP cells | Skin | Homo sapiens (Human) | N.A. | |
WM451 cells | Skin | Homo sapiens (Human) | CVCL_6357 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometric analysis | |||
Mechanism Description | microRNA-488-3p sensitizes malignant melanoma cells to cisplatin by targeting PRkDC. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.