Molecule Information

General Information of the Molecule (ID: Mol01722)

• Name: hsa-miR-488-3p ,Homo sapiens
• Synonyms: microRNA 488
• Molecule Type: Mature miRNA
• Sequence: UUGAAAGGCUAUUUCUUGGUC
• Ensembl ID: ENSG00000202609
• HGNC ID: HGNC:32073
• Mature Accession: MIMAT0004763

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Melanoma [1]

• Sensitive Disease: Melanoma [ICD-11: 2C30.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A375 cells; Skin; Homo sapiens (Human); CVCL_0132
• In Vitro Model: Sk-Mel28 cells; Skin; Homo sapiens (Human); CVCL_0526
• In Vitro Model: B16 cells; Skin; Homo sapiens (Human); CVCL_F936
• In Vitro Model: HEMn-LP cells; Skin; Homo sapiens (Human); N.A.
• In Vitro Model: WM451 cells; Skin; Homo sapiens (Human); CVCL_6357
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis
• Mechanism Description: microRNA-488-3p sensitizes malignant melanoma cells to cisplatin by targeting PRkDC.

References

• Ref 1: MicroRNA-488-3p sensitizes malignant melanoma cells to cisplatin by targeting PRKDC. Cell Biol Int. 2017 Jun;41(6):622-629. doi: 10.1002/cbin.10765. Epub 2017 Apr 7.