Molecule Information

General Information of the Molecule (ID: Mol01721)

• Name: hsa-miR-483-5p ,Homo sapiens
• Synonyms: microRNA 483
• Molecule Type: Mature miRNA
• Sequence: AAGACGGGAGGAAAGAAGGGAG
• Ensembl ID: ENSG00000207805
• HGNC ID: HGNC:32340
• Mature Accession: MIMAT0004761

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Tongue squamous cell carcinoma [1]

• Resistant Disease: Tongue squamous cell carcinoma [ICD-11: 2B62.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Mitochondrial apoptotic signaling pathway; Regulation; hsa04210
• In Vitro Model: CAL27 cells; Oral; Homo sapiens (Human); CVCL_1107
• In Vitro Model: SCC9 cells; Tongue; Homo sapiens (Human); CVCL_1685
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: TUNEL assay; Flow cytometry assay
• Mechanism Description: FIS1 is able to regulate mitochondrial fission and cisplatin sensitivity. miR-483-5p is responsible for the downregulation of FIS1 and can suppress mitochondrial fission and apoptosis by targeting FIS1. Mitochondrial fission affects cisplatin sensitivity via the miR-483-5p-FIS1 axis in cancer cells.

References

• Ref 1: miR-483-5p determines mitochondrial fission and cisplatin sensitivity in tongue squamous cell carcinoma by targeting FIS1. Cancer Lett. 2015 Jul 1;362(2):183-91. doi: 10.1016/j.canlet.2015.03.045. Epub 2015 Apr 2.