Molecule Information

General Information of the Molecule (ID: Mol01720)

• Name: hsa-miR-20b-3p ,Homo sapiens
• Synonyms: microRNA 20b
• Molecule Type: Mature miRNA
• Sequence: ACUGUAGUAUGGGCACUUCCAG
• Ensembl ID: ENSG00000284043
• HGNC ID: HGNC:32024
• Mature Accession: MIMAT0004752

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Temozolomide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [1]

• Resistant Disease: Glioblastoma [ICD-11: 2A00.02]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: c-Met signaling signaling pathway; Inhibition; hsa01521
• In Vitro Model: HG7 cells; Brain; Homo sapiens (Human); N.A.
• In Vitro Model: LN229 cells; Brain; Homo sapiens (Human); CVCL_0393
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Colony formation assay; Flow cytometry assay
• Mechanism Description: Lnc-TALC promotes O6-methylguanine-DNA methyltransferase expression via regulating the c-Met pathway by competitively binding with miR-20b-3p.

Disease Class: Glioblastoma [1]

• Resistant Disease: Glioblastoma [ICD-11: 2A00.02]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: c-Met signaling signaling pathway; Inhibition; hsa01521
• In Vitro Model: HG7 cells; Brain; Homo sapiens (Human); N.A.
• In Vitro Model: LN229 cells; Brain; Homo sapiens (Human); CVCL_0393
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: Western blot analysis; RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Colony formation assay; Flow cytometry assay
• Mechanism Description: Lnc-TALC promotes O6-methylguanine-DNA methyltransferase expression via regulating the c-Met pathway by competitively binding with miR-20b-3p.

References

• Ref 1: Lnc-TALC promotes O(6)-methylguanine-DNA methyltransferase expression via regulating the c-Met pathway by competitively binding with miR-20b-3p. Nat Commun. 2019 May 3;10(1):2045. doi: 10.1038/s41467-019-10025-2.