Molecule Information

General Information of the Molecule (ID: Mol01719)

• Name: hsa-miR-424-3p ,Homo sapiens
• Synonyms: microRNA 424
• Molecule Type: Mature miRNA
• Sequence: CAAAACGUGAGGCGCUGCUAU
• Ensembl ID: ENSG00000284231
• HGNC ID: HGNC:31881
• Mature Accession: MIMAT0004749

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: TOV21G cells; Ovary; Homo sapiens (Human); CVCL_3613
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: XTT assay
• Mechanism Description: We demonstrated that miR-424-3p mimic effectively transfects into SK-OV-3 and TOV-21G ovarian cancer cells in which it significantly suppresses the expression of galectin-3 at the protein level, but not at the mRNA level. Reverse transfection of both cell lines with the mimic, followed by treatment with cisplatin, resulted in a reduction in cell viability and proliferation as well as an increase in the induction of apoptosis.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [2]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: NCI-H441 cells; Lung; Homo sapiens (Human); CVCL_1561
• In Vitro Model: H2172 cells; Lung; Homo sapiens (Human); CVCL_1537
• In Vitro Model: H827 cells; Lung; Homo sapiens (Human); N.A.
• In Vitro Model: PC-14 cells; Lung; Homo sapiens (Human); CVCL_1640
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Wound-healing and Transwell assay
• Mechanism Description: miR-424-3p was discovered to suppress the level of YAP1 protein by targeting its 3' untranslated region, suggesting that miR-424-3p could be a potential molecular target for treatment of NSCLC with chemoresistance.

Clinical Trial Drug(s) 1 drug(s) in total

PLX4720

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Papillary thyroid carcinoma [ICD-11: 2D10.1] [3]

• Resistant Disease: Papillary thyroid carcinoma [ICD-11: 2D10.1]
• Resistant Drug: PLX4720
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: Immunoblot analysis; qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: This gene is down-regulated in PLX4720-resistance cells

References

• Ref 1: Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.
• Ref 2: Loss of MiR-424-3p, not miR-424-5p, confers chemoresistance through targeting YAP1 in non-small cell lung cancer. Mol Carcinog. 2017 Mar;56(3):821-832. doi: 10.1002/mc.22536. Epub 2016 Aug 26.
• Ref 3: Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.