Molecule Information

General Information of the Molecule (ID: Mol01719)

• Name: hsa-miR-424-3p ,Homo sapiens
• Synonyms: microRNA 424
• Molecule Type: Mature miRNA
• Sequence: CAAAACGUGAGGCGCUGCUAU
• Ensembl ID: ENSG00000284231
• HGNC ID: HGNC:31881
• Mature Accession: MIMAT0004749

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: NCI-H441 cells; Lung; Homo sapiens (Human); CVCL_1561
• In Vitro Model: H2172 cells; Lung; Homo sapiens (Human); CVCL_1537
• In Vitro Model: H827 cells; Lung; Homo sapiens (Human); N.A.
• In Vitro Model: PC-14 cells; Lung; Homo sapiens (Human); CVCL_1640
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Wound-healing and Transwell assay
• Mechanism Description: miR-424-3p was discovered to suppress the level of YAP1 protein by targeting its 3' untranslated region, suggesting that miR-424-3p could be a potential molecular target for treatment of NSCLC with chemoresistance.

References

• Ref 1: Loss of MiR-424-3p, not miR-424-5p, confers chemoresistance through targeting YAP1 in non-small cell lung cancer. Mol Carcinog. 2017 Mar;56(3):821-832. doi: 10.1002/mc.22536. Epub 2016 Aug 26.