Molecule Information
General Information of the Molecule (ID: Mol01719)
Name |
hsa-miR-424-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 424
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
CAAAACGUGAGGCGCUGCUAU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [1] | |||
Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Sensitive Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
Cell migration | Inhibition | hsa04670 | ||
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | H1975 cells | Lung | Homo sapiens (Human) | CVCL_1511 |
A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
NCI-H441 cells | Lung | Homo sapiens (Human) | CVCL_1561 | |
H2172 cells | Lung | Homo sapiens (Human) | CVCL_1537 | |
H827 cells | Lung | Homo sapiens (Human) | N.A. | |
PC-14 cells | Lung | Homo sapiens (Human) | CVCL_1640 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Wound-healing and Transwell assay | |||
Mechanism Description | miR-424-3p was discovered to suppress the level of YAP1 protein by targeting its 3' untranslated region, suggesting that miR-424-3p could be a potential molecular target for treatment of NSCLC with chemoresistance. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.