Molecule Information
General Information of the Molecule (ID: Mol01719)
| Name |
hsa-miR-424-3p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 424
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
CAAAACGUGAGGCGCUGCUAU
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [1] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | H1975 cells | Lung | Homo sapiens (Human) | CVCL_1511 |
| A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| NCI-H441 cells | Lung | Homo sapiens (Human) | CVCL_1561 | |
| H2172 cells | Lung | Homo sapiens (Human) | CVCL_1537 | |
| H827 cells | Lung | Homo sapiens (Human) | N.A. | |
| PC-14 cells | Lung | Homo sapiens (Human) | CVCL_1640 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Wound-healing and Transwell assay | |||
| Mechanism Description | miR-424-3p was discovered to suppress the level of YAP1 protein by targeting its 3' untranslated region, suggesting that miR-424-3p could be a potential molecular target for treatment of NSCLC with chemoresistance. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
