General Information of the Molecule (ID: Mol01712)
Name
hsa-miR-155-3p ,Homo sapiens
Synonyms
microRNA 155
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
CUCCUACAUAUUAGCAUUAACA
    Click to Show/Hide
Ensembl ID
ENSG00000283904
HGNC ID
HGNC:31542
Mature Accession
MIMAT0004658
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [1]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell viability Activation hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
SRB assay
Mechanism Description miR-155-3p acts as a tumor suppressor and reverses paclitaxel resistance via negative regulation of MYD88 in human breast cancer.
References
Ref 1 MiR-155-3p acts as a tumor suppressor and reverses paclitaxel resistance via negative regulation of MYD88 in human breast cancer. Gene. 2019 Jun 5;700:85-95. doi: 10.1016/j.gene.2019.02.066. Epub 2019 Mar 13.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.