Molecule Information

General Information of the Molecule (ID: Mol01712)

• Name: hsa-miR-155-3p ,Homo sapiens
• Synonyms: microRNA 155
• Molecule Type: Mature miRNA
• Sequence: CUCCUACAUAUUAGCAUUAACA
• Ensembl ID: ENSG00000283904
• HGNC ID: HGNC:31542
• Mature Accession: MIMAT0004658

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: SRB assay
• Mechanism Description: miR-155-3p acts as a tumor suppressor and reverses paclitaxel resistance via negative regulation of MYD88 in human breast cancer.

References

• Ref 1: MiR-155-3p acts as a tumor suppressor and reverses paclitaxel resistance via negative regulation of MYD88 in human breast cancer. Gene. 2019 Jun 5;700:85-95. doi: 10.1016/j.gene.2019.02.066. Epub 2019 Mar 13.