General Information of the Molecule (ID: Mol01708)
Name
hsa-miR-130a-5p ,Homo sapiens
Synonyms
microRNA 130a
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
GCUCUUUUCACAUUGUGCUACU
    Click to Show/Hide
Ensembl ID
ENSG00000208009
HGNC ID
HGNC:31514
Mature Accession
MIMAT0004593
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [1]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Tamoxifen
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description Downregulated LncRNA ADAMTS9-AS2 in breast cancer enhances tamoxifen resistance by activating microRNA-130a-5p.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [1]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Tamoxifen
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description Low expression of ADAMTS9-AS2 inhibits PTEN expression and enhances tamoxifen resistance through targeting microRNA-130a-5p.
References
Ref 1 Downregulated lncRNA ADAMTS9-AS2 in breast cancer enhances tamoxifen resistance by activating microRNA-130a-5p. Eur Rev Med Pharmacol Sci. 2019 Feb;23(4):1563-1573. doi: 10.26355/eurrev_201902_17115.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.