Molecule Information

General Information of the Molecule (ID: Mol01707)

• Name: hsa-miR-30c-2-3p ,Homo sapiens
• Synonyms: microRNA 30c-2
• Molecule Type: Mature miRNA
• Sequence: CUGGGAGAAGGCUGUUUACUCU
• Ensembl ID: ENSG00000199094
• HGNC ID: HGNC:31627
• Mature Accession: MIMAT0004550

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• In Vitro Model: TL-1 cells; Lung; Homo sapiens (Human); CVCL_B371
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Immunohistochemical staining assay
• Mechanism Description: miR-30c-2* negative regulated MTA-1 expression involved in metastasis and reducing drug resistance of HPV-infected non-small cell lung cancer.

References

• Ref 1: MiR-30c-2* negative regulated MTA-1 expression involved in metastasis and drug resistance of HPV-infected non-small cell lung cancer. Surgery. 2016 Dec;160(6):1591-1598. doi: 10.1016/j.surg.2016.06.025. Epub 2016 Aug 6.