General Information of the Molecule (ID: Mol01705)
Name
hsa-miR-93-3p ,Homo sapiens
Synonyms
microRNA 93
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
ACUGCUGAGCUAGCACUUCCCG
    Click to Show/Hide
Ensembl ID
ENSG00000207757
HGNC ID
HGNC:31645
Mature Accession
MIMAT0004509
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [1]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Wnt/Beta-catenin signaling pathway Activation hsa04310
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
AU565 cells Breast Homo sapiens (Human) CVCL_1074
BT-483 cells Breast Homo sapiens (Human) CVCL_2319
BT549 cells Breast Homo sapiens (Human) CVCL_1092
DU4475 cells Breast Homo sapiens (Human) CVCL_1183
HCC1599 cells Breast Homo sapiens (Human) CVCL_1256
HCC1806 cells Breast Homo sapiens (Human) CVCL_1258
HCC1937 cells Breast Homo sapiens (Human) CVCL_0290
HCC70 cells Breast Homo sapiens (Human) CVCL_1270
Hs-578T cells Breast Homo sapiens (Human) CVCL_0332
MB-361 cells Breast Homo sapiens (Human) CVCL_0620
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR105/93-3p activates Wnt/beta-catenin signaling by downregulating SFRP1 and thereby promotes stemness, chemoresistance, and metastasis in TNBC cells.
References
Ref 1 miR-105/93-3p promotes chemoresistance and circulating miR-105/93-3p acts as a diagnostic biomarker for triple negative breast cancer. Breast Cancer Res. 2017 Dec 19;19(1):133. doi: 10.1186/s13058-017-0918-2.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.