Molecule Information
General Information of the Molecule (ID: Mol01705)
Name |
hsa-miR-93-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 93
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
ACUGCUGAGCUAGCACUUCCCG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [1] | |||
Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Wnt/Beta-catenin signaling pathway | Activation | hsa04310 | |
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
SkBR3 cells | Breast | Homo sapiens (Human) | CVCL_0033 | |
MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
AU565 cells | Breast | Homo sapiens (Human) | CVCL_1074 | |
BT-483 cells | Breast | Homo sapiens (Human) | CVCL_2319 | |
BT549 cells | Breast | Homo sapiens (Human) | CVCL_1092 | |
DU4475 cells | Breast | Homo sapiens (Human) | CVCL_1183 | |
HCC1599 cells | Breast | Homo sapiens (Human) | CVCL_1256 | |
HCC1806 cells | Breast | Homo sapiens (Human) | CVCL_1258 | |
HCC1937 cells | Breast | Homo sapiens (Human) | CVCL_0290 | |
HCC70 cells | Breast | Homo sapiens (Human) | CVCL_1270 | |
Hs-578T cells | Breast | Homo sapiens (Human) | CVCL_0332 | |
MB-361 cells | Breast | Homo sapiens (Human) | CVCL_0620 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR105/93-3p activates Wnt/beta-catenin signaling by downregulating SFRP1 and thereby promotes stemness, chemoresistance, and metastasis in TNBC cells. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.