Molecule Information

General Information of the Molecule (ID: Mol01703)

• Name: hsa-miR-19b-1-5p ,Homo sapiens
• Synonyms: microRNA 19b-1
• Molecule Type: Mature miRNA
• Sequence: AGUUUUGCAGGUUUGCAUCCAGC
• Ensembl ID: ENSG00000284375
• HGNC ID: HGNC:31575
• Mature Accession: MIMAT0004491

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Nasopharyngeal carcinoma [1]

• Sensitive Disease: Nasopharyngeal carcinoma [ICD-11: 2B6B.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HNE1 cells; Nasopharynx; Homo sapiens (Human); CVCL_0308
• In Vitro Model: CNE1 cells; Throat; Homo sapiens (Human); CVCL_6888
• In Vitro Model: NP69 cells; Nasopharynx; Homo sapiens (Human); CVCL_F755
• In Vitro Model: SUNE-1 cells; Nasopharynx; Homo sapiens (Human); CVCL_6946
• In Vitro Model: C666 cells; Nasopharyngeal; Homo sapiens (Human); CVCL_M597
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: microRNA-19b Promotes Nasopharyngeal Carcinoma More Sensitive to Cisplatin by Suppressing kRAS.

References

• Ref 1: MicroRNA-19b Promotes Nasopharyngeal Carcinoma More Sensitive to Cisplatin by Suppressing KRAS. Technol Cancer Res Treat. 2018 Jan 1;17:1533033818793652. doi: 10.1177/1533033818793652.