Molecule Information
General Information of the Molecule (ID: Mol01703)
| Name |
hsa-miR-19b-1-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 19b-1
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
AGUUUUGCAGGUUUGCAUCCAGC
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Nasopharyngeal carcinoma [ICD-11: 2B6B.0] | [1] | |||
| Sensitive Disease | Nasopharyngeal carcinoma [ICD-11: 2B6B.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | HNE1 cells | Nasopharynx | Homo sapiens (Human) | CVCL_0308 |
| CNE1 cells | Throat | Homo sapiens (Human) | CVCL_6888 | |
| NP69 cells | Nasopharynx | Homo sapiens (Human) | CVCL_F755 | |
| SUNE-1 cells | Nasopharynx | Homo sapiens (Human) | CVCL_6946 | |
| C666 cells | Nasopharyngeal | Homo sapiens (Human) | CVCL_M597 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | microRNA-19b Promotes Nasopharyngeal Carcinoma More Sensitive to Cisplatin by Suppressing kRAS. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
