General Information of the Molecule (ID: Mol01701)
Name
hsa-miR-675-5p ,Homo sapiens
Synonyms
microRNA 675
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGGUGCGGAGAGGGCCCACAGUG
    Click to Show/Hide
Ensembl ID
ENSG00000284010
HGNC ID
HGNC:33351
Mature Accession
MIMAT0004284
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Calcitriol
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [1]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
Resistant Drug Calcitriol
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Wnt/Beta-catenin signaling pathway Inhibition hsa04310
In Vitro Model DLD1 cells Colon Homo sapiens (Human) CVCL_0248
HT-29 cells Colon Homo sapiens (Human) CVCL_0320
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description H19 overexpression induces resistance to 1,25(OH)2D3 by inhibiting the expression of VDR Through miR675-5p in colon cancer cells. vdr signaling was able to attenuate the proliferation and migration of colon cancer cells via multiple mechanisms including inhibiting Wnt/beta-catenin pathway, VDR signaling inhibits the expression of h19 by regulating the C-Myc/mad-1 Network.
Investigative Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Huaier extract
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [2]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Huaier extract
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation LncRH19/MiR675-5p signaling pathway Regulation hsa05206
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
MDA-MB-468 cells Breast Homo sapiens (Human) CVCL_0419
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
Flow cytometry assay; MTT assay
Mechanism Description miR675-5p was identified as a mature product of H19. The overexpression of H19 or miR675-5p reverses the tumor-inhibitory effects of Huaier extract. However, knocking down H19 or miR675-5p sensitizes breast cancer cells to Huaier extract. Huaier extract inhibits breast cancer cell proliferation and induces apoptosis via the LncRNA H19/miR675-5p/CBL signaling pathway.
References
Ref 1 H19 Overexpression Induces Resistance to 1,25(OH)2D3 by Targeting VDR Through miR-675-5p in Colon Cancer Cells. Neoplasia. 2017 Mar;19(3):226-236. doi: 10.1016/j.neo.2016.10.007. Epub 2017 Feb 8.
Ref 2 Huaier Extract Inhibits Breast Cancer Progression Through a LncRNA-H19/MiR-675-5p Pathway. Cell Physiol Biochem. 2017;44(2):581-593. doi: 10.1159/000485093. Epub 2017 Nov 17.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.