Molecule Information
General Information of the Molecule (ID: Mol01701)
| Name |
hsa-miR-675-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 675
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UGGUGCGGAGAGGGCCCACAGUG
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [1] | |||
| Resistant Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Resistant Drug | Calcitriol | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Wnt/Beta-catenin signaling pathway | Inhibition | hsa04310 | |
| In Vitro Model | DLD1 cells | Colon | Homo sapiens (Human) | CVCL_0248 |
| HT-29 cells | Colon | Homo sapiens (Human) | CVCL_0320 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | H19 overexpression induces resistance to 1,25(OH)2D3 by inhibiting the expression of VDR Through miR675-5p in colon cancer cells. vdr signaling was able to attenuate the proliferation and migration of colon cancer cells via multiple mechanisms including inhibiting Wnt/beta-catenin pathway, VDR signaling inhibits the expression of h19 by regulating the C-Myc/mad-1 Network. | |||
Investigative Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [2] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Huaier extract | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | LncRH19/MiR675-5p signaling pathway | Regulation | N.A. | |
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| MDA-MB-468 cells | Breast | Homo sapiens (Human) | CVCL_0419 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay; MTT assay | |||
| Mechanism Description | miR675-5p was identified as a mature product of H19. The overexpression of H19 or miR675-5p reverses the tumor-inhibitory effects of Huaier extract. However, knocking down H19 or miR675-5p sensitizes breast cancer cells to Huaier extract. Huaier extract inhibits breast cancer cell proliferation and induces apoptosis via the LncRNA H19/miR675-5p/CBL signaling pathway. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
