General Information of the Molecule (ID: Mol01700)
Name
hsa-miR-770-5p ,Homo sapiens
Synonyms
microRNA 770
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UCCAGUACCACGUGUCAGGGCCA
    Click to Show/Hide
Ensembl ID
ENSG00000211574
HGNC ID
HGNC:33143
Mature Accession
MIMAT0003948
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [1]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model A2780CP cells Ovary Homo sapiens (Human) CVCL_0135
C13 cells Ovary Homo sapiens (Human) CVCL_0114
Experiment for
Molecule Alteration
qRT-PCR; ISH
Experiment for
Drug Resistance
Flow cytometry assay; TUNEL assay
Mechanism Description miR-770-5p inhibits cisplatin chemoresistance in human ovarian cancer by targeting and reducing the level of ERCC2.
Trastuzumab
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: HER2 positive breast cancer [2]
Sensitive Disease HER2 positive breast cancer [ICD-11: 2C60.8]
Sensitive Drug Trastuzumab
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
HER2 signaling pathway Activation hsa04012
In Vitro Model SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
BT474 cells Breast Homo sapiens (Human) CVCL_0179
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
WST1 assay
Mechanism Description miR-770-5p overexpression downregulated HER2 and increased the effect of trastuzumab.
References
Ref 1 MiR-770-5p inhibits cisplatin chemoresistance in human ovarian cancer by targeting ERCC2. Oncotarget. 2016 Aug 16;7(33):53254-53268. doi: 10.18632/oncotarget.10736.
Ref 2 Involvement of miR-770-5p in trastuzumab response in HER2 positive breast cancer cells. PLoS One. 2019 Apr 22;14(4):e0215894. doi: 10.1371/journal.pone.0215894. eCollection 2019.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.