Molecule Information

General Information of the Molecule (ID: Mol01697)

Name	hsa-miR-454-3p ,Homo sapiens
Synonyms	microRNA 454 Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	UAGUGCAAUAUUGCUUAUAGGGU Click to Show/Hide
Ensembl ID	ENSG00000211514
HGNC ID	HGNC:33137
Mature Accession	MIMAT0003885
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s)

1 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Regulation by the Disease Microenvironment (RTDM)			Click to Show/Hide
Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0]				[1]
Resistant Disease	Lung adenocarcinoma [ICD-11: 2C25.0]			Disease Info
Resistant Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell invasion		Activation	hsa05200
	Cell migration		Activation	hsa04670
	Cell viability		Activation	hsa05200
In Vitro Model	A549 cells	Lung	Homo sapiens (Human)	CVCL_0023
	H157 cells	Lung	Homo sapiens (Human)	CVCL_2458
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTT assay; Flow cytometry assay
Mechanism Description	LncRNA HOXA11-AS drives cisplatin resistance of human LUAD cells via upregulating Stat3 by sequestering miR-454-3p.

References

Ref 1	LncRNA HOXA11-AS drives cisplatin resistance of human LUAD cells via modulating miR-454-3p/Stat3. Cancer Sci. 2018 Oct;109(10):3068-3079. doi: 10.1111/cas.13764. Epub 2018 Sep 2.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.