Molecule Information

General Information of the Molecule (ID: Mol01697)

• Name: hsa-miR-454-3p ,Homo sapiens
• Synonyms: microRNA 454
• Molecule Type: Mature miRNA
• Sequence: UAGUGCAAUAUUGCUUAUAGGGU
• Ensembl ID: ENSG00000211514
• HGNC ID: HGNC:33137
• Mature Accession: MIMAT0003885

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Lung adenocarcinoma [1]

• Resistant Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H157 cells; Lung; Homo sapiens (Human); CVCL_2458
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: LncRNA HOXA11-AS drives cisplatin resistance of human LUAD cells via upregulating Stat3 by sequestering miR-454-3p.

References

• Ref 1: LncRNA HOXA11-AS drives cisplatin resistance of human LUAD cells via modulating miR-454-3p/Stat3. Cancer Sci. 2018 Oct;109(10):3068-3079. doi: 10.1111/cas.13764. Epub 2018 Sep 2.