Molecule Information

General Information of the Molecule (ID: Mol01695)

• Name: hsa-miR-542-3p ,Homo sapiens
• Synonyms: microRNA 542
• Molecule Type: Mature miRNA
• Sequence: UGUGACAGAUUGAUAACUGAAA
• Ensembl ID: ENSG00000207784
• HGNC ID: HGNC:32534
• Mature Accession: MIMAT0003389

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Trastuzumab

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Trastuzumab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: MCF7/HER2 cells; Breast; Homo sapiens (Human); CVCL_0U80
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Trastuzumab induced miRNA 542 3p expression in SkBR3 and MCF7/Her2 cells. Furthermore, knockdown of miRNA 542 3p in the two cell lines resulted in decreased drug sensitivity to trastuzumab and cell apoptosis. The blockage of G1/S checkpoint by trastuzumab was rescued as well. miRNA 542 3p knockdown also activated the phosphatidylinositol 3 kinase (PI3k) Akt pathway, while LY294002 reversed the effect of miRNA 542 3p knockdown. In summary, the results suggested that miRNA 542 3p downregulation may contribute to the trastuzumab resistance in breast cancer via, at least in part, the PI3k akt pathway.

References

• Ref 1: MiRNA 542 3p downregulation promotes trastuzumab resistance in breast cancer cells via AKT activation. Oncol Rep. 2015 Mar;33(3):1215-20. doi: 10.3892/or.2015.3713. Epub 2015 Jan 13.