General Information of the Molecule (ID: Mol01695)
Name
hsa-miR-542-3p ,Homo sapiens
Synonyms
microRNA 542
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGUGACAGAUUGAUAACUGAAA
    Click to Show/Hide
Ensembl ID
ENSG00000207784
HGNC ID
HGNC:32534
Mature Accession
MIMAT0003389
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Trastuzumab
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [1]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Trastuzumab
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
MCF7/HER2 cells Breast Homo sapiens (Human) CVCL_0U80
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Trastuzumab induced miRNA 542 3p expression in SkBR3 and MCF7/Her2 cells. Furthermore, knockdown of miRNA 542 3p in the two cell lines resulted in decreased drug sensitivity to trastuzumab and cell apoptosis. The blockage of G1/S checkpoint by trastuzumab was rescued as well. miRNA 542 3p knockdown also activated the phosphatidylinositol 3 kinase (PI3k) Akt pathway, while LY294002 reversed the effect of miRNA 542 3p knockdown. In summary, the results suggested that miRNA 542 3p downregulation may contribute to the trastuzumab resistance in breast cancer via, at least in part, the PI3k akt pathway.
References
Ref 1 MiRNA 542 3p downregulation promotes trastuzumab resistance in breast cancer cells via AKT activation. Oncol Rep. 2015 Mar;33(3):1215-20. doi: 10.3892/or.2015.3713. Epub 2015 Jan 13.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.