Molecule Information
      General Information of the Molecule (ID: Mol01695)
  
  | Name | hsa-miR-542-3p
                                ,Homo sapiens
                               | ||||
|---|---|---|---|---|---|
| Synonyms | microRNA 542     Click to Show/Hide | ||||
| Molecule Type | Mature miRNA | ||||
| Sequence | UGUGACAGAUUGAUAACUGAAA     Click to Show/Hide | ||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
      Type(s) of Resistant Mechanism of This Molecule
  
  
      Drug Resistance Data Categorized by Drug
  
  Approved Drug(s)
      1 drug(s) in total
      
    | Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|  | ||||
| Disease Class: Breast cancer | [1] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Trastuzumab | |||
| Molecule Alteration | Expression | Up-regulation | ||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
| In Vitro Model | SkBR3 cells | Breast | Homo sapiens (Human) | CVCL_0033 | 
| MCF7/HER2 cells | Breast | Homo sapiens (Human) | CVCL_0U80 | |
| Experiment for Molecule Alteration | RT-qPCR | |||
| Experiment for Drug Resistance | MTT assay | |||
| Mechanism Description | Trastuzumab induced miRNA 542 3p expression in SkBR3 and MCF7/Her2 cells. Furthermore, knockdown of miRNA 542 3p in the two cell lines resulted in decreased drug sensitivity to trastuzumab and cell apoptosis. The blockage of G1/S checkpoint by trastuzumab was rescued as well. miRNA 542 3p knockdown also activated the phosphatidylinositol 3 kinase (PI3k) Akt pathway, while LY294002 reversed the effect of miRNA 542 3p knockdown. In summary, the results suggested that miRNA 542 3p downregulation may contribute to the trastuzumab resistance in breast cancer via, at least in part, the PI3k akt pathway. | |||
      References
  
  visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.
