Molecule Information

General Information of the Molecule (ID: Mol01695)

• Name: hsa-miR-542-3p ,Homo sapiens
• Synonyms: microRNA 542
• Molecule Type: Mature miRNA
• Sequence: UGUGACAGAUUGAUAACUGAAA
• Ensembl ID: ENSG00000207784
• HGNC ID: HGNC:32534
• Mature Accession: MIMAT0003389

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: CP70 cells; Ovary; Homo sapiens (Human); CVCL_0135
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Cell viability assays
• Mechanism Description: Out of 11 miRNAs that showed differential expression, 5 were up-regulated and 6 were down regulated in A2780/CP70 cell line compared to A2780 cell line. Up-regulated miRNAs include hsa-miRplus-F1064, hsa-miR-300, hsa-miR-193b, hsa-miR-642, and hsa-miR-1299. Out of 11 miRNA, 6 were down-regulated: hsa-miR-625, hsa-miR-20b, hsa-miRPlus-F1147, hsa-let-7c, hsa-miRPlus-F1231, and hsa-miR-542-3p.

Etoposide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: qRT-PCR, Reverse Transcription and Running ABC Transporter TLDA
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Using miRNA microfluidic arrays from ABI, we determined the microRNA profile for MCF7VP cells compared to drug sensitive cells. Multiple miRNAs showed differential expression among the cell lines including hsa-miR-382, hsa-miR-23b and hsa-miR-885-5p, which were up-regulated (>2-fold increase) in MCF7VP cells and hsa-mir-218, hsa-miR-758 and hsa-miR-548d-5p, which were down-regulated (>2-fold decrease) in MCF7VP cells, suggesting that etoposide resistant MCF7 cells have a miRNA profile that is distinct from the MCF7 drug sensitive cell line.

Trastuzumab

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Trastuzumab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: MCF7/HER2 cells; Breast; Homo sapiens (Human); CVCL_0U80
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Trastuzumab induced miRNA 542 3p expression in SkBR3 and MCF7/Her2 cells. Furthermore, knockdown of miRNA 542 3p in the two cell lines resulted in decreased drug sensitivity to trastuzumab and cell apoptosis. The blockage of G1/S checkpoint by trastuzumab was rescued as well. miRNA 542 3p knockdown also activated the phosphatidylinositol 3 kinase (PI3k) Akt pathway, while LY294002 reversed the effect of miRNA 542 3p knockdown. In summary, the results suggested that miRNA 542 3p downregulation may contribute to the trastuzumab resistance in breast cancer via, at least in part, the PI3k akt pathway.

References

• Ref 1: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
• Ref 2: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
• Ref 3: MiRNA 542 3p downregulation promotes trastuzumab resistance in breast cancer cells via AKT activation. Oncol Rep. 2015 Mar;33(3):1215-20. doi: 10.3892/or.2015.3713. Epub 2015 Jan 13.