Molecule Information

General Information of the Molecule (ID: Mol01693)

• Name: hsa-miR-660-5p ,Homo sapiens
• Synonyms: microRNA 660
• Molecule Type: Mature miRNA
• Sequence: UACCCAUUGCAUAUCGGAGUUG
• Ensembl ID: ENSG00000207970
• HGNC ID: HGNC:32916
• Mature Accession: MIMAT0003338

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Dasatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [1]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Dasatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Lin-CD34+CD38- cells; Bone; Homo sapiens (Human); N.A.
• In Vitro Model: Lin-CD34-CD38- CML cells; Bone; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Annexin V assay
• Mechanism Description: The up-regulation of miR660-5p observed in CML LSCs led to the down-regulation of its target EPAS1 and conferred TkI-resistance to CML LSCs in vitro.

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [1]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Lin-CD34+CD38- cells; Bone; Homo sapiens (Human); N.A.
• In Vitro Model: Lin-CD34-CD38- CML cells; Bone; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Annexin V assay
• Mechanism Description: The up-regulation of miR660-5p observed in CML LSCs led to the down-regulation of its target EPAS1 and conferred TkI-resistance to CML LSCs in vitro.

Ponatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [1]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Ponatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Lin-CD34+CD38- cells; Bone; Homo sapiens (Human); N.A.
• In Vitro Model: Lin-CD34-CD38- CML cells; Bone; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Annexin V assay
• Mechanism Description: The up-regulation of miR660-5p observed in CML LSCs led to the down-regulation of its target EPAS1 and conferred TkI-resistance to CML LSCs in vitro.

References

• Ref 1: Deregulated expression of miR-29a-3p, miR-494-3p and miR-660-5p affects sensitivity to tyrosine kinase inhibitors in CML leukemic stem cells. Oncotarget. 2017 Jul 25;8(30):49451-49469. doi: 10.18632/oncotarget.17706.