Molecule Information

General Information of the Molecule (ID: Mol01681)

• Name: hsa-miR-631 ,Homo sapiens
• Synonyms: microRNA 631
• Molecule Type: Mature miRNA
• Sequence: AGACCUGGCCCAGACCUCAGC
• Ensembl ID: ENSG00000284343
• HGNC ID: HGNC:32887
• Mature Accession: MIMAT0003300

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Bortezomib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Multiple myeloma [1]

• Sensitive Disease: Multiple myeloma [ICD-11: 2A83.0]
• Sensitive Drug: Bortezomib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: miR631/UbcH10/MDR1 signaling pathway; Regulation; hsa05206
• In Vitro Model: NCI-H929 cells; Bone marrow; Homo sapiens (Human); CVCL_1600
• In Vitro Model: U266 cells; Bone marrow; Homo sapiens (Human); CVCL_0566
• In Vitro Model: RPMI-8226/BTZ cells; Pancreas; Homo sapiens (Human); CVCL_XK17
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Hsa-miR631 resensitizes bortezomib-resistant multiple myeloma cell lines by inhibiting UbcH10.

References

• Ref 1: hsa-miR-631 resensitizes bortezomib-resistant multiple myeloma cell lines by inhibiting UbcH10. Oncol Rep. 2017 Feb;37(2):961-968. doi: 10.3892/or.2016.5318. Epub 2016 Dec 14.