Molecule Information
General Information of the Molecule (ID: Mol01681)
Name |
hsa-miR-631
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 631
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
AGACCUGGCCCAGACCUCAGC
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Multiple myeloma | [1] | |||
Sensitive Disease | Multiple myeloma [ICD-11: 2A83.0] | |||
Sensitive Drug | Bortezomib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | miR631/UbcH10/MDR1 signaling pathway | Regulation | hsa05206 | |
In Vitro Model | NCI-H929 cells | Bone marrow | Homo sapiens (Human) | CVCL_1600 |
U266 cells | Bone marrow | Homo sapiens (Human) | CVCL_0566 | |
RPMI-8226/BTZ cells | Pancreas | Homo sapiens (Human) | CVCL_XK17 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Hsa-miR631 resensitizes bortezomib-resistant multiple myeloma cell lines by inhibiting UbcH10. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.