Molecule Information
General Information of the Molecule (ID: Mol01681)
| Name |
hsa-miR-631
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 631
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
AGACCUGGCCCAGACCUCAGC
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Multiple myeloma [ICD-11: 2A83.0] | [1] | |||
| Sensitive Disease | Multiple myeloma [ICD-11: 2A83.0] | |||
| Sensitive Drug | Bortezomib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | miR631/UbcH10/MDR1 signaling pathway | Regulation | N.A. | |
| In Vitro Model | NCI-H929 cells | Bone marrow | Homo sapiens (Human) | CVCL_1600 |
| U266 cells | Bone marrow | Homo sapiens (Human) | CVCL_0566 | |
| RPMI-8226/BTZ cells | Pancreas | Homo sapiens (Human) | CVCL_XK17 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Hsa-miR631 resensitizes bortezomib-resistant multiple myeloma cell lines by inhibiting UbcH10. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
