Molecule Information
General Information of the Molecule (ID: Mol01677)
Name |
hsa-miR-613
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 613
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
AGGAAUGUUCCUUCUUUGCC
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Liver cancer | [1] | |||
Resistant Disease | Liver cancer [ICD-11: 2C12.6] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
SOX9 signaling pathway | Activation | hsa04024 | ||
In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
HCCLM3 cells | Liver | Homo sapiens (Human) | CVCL_6832 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | The drug sensitivity of HCC to sorafenib and cisplatin was significantly decreased when miR-613 was knockdown, suggesting that miR-613 played a possible role in the treatment of HCC drug resistance. | |||
Disease Class: Gastric cancer | [2] | |||
Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
Cell migration | Activation | hsa04670 | ||
Cell viability | Activation | hsa05200 | ||
In Vitro Model | MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 |
SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
HGC27 cells | Gastric | Homo sapiens (Human) | CVCL_1279 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Wound healing assay | |||
Mechanism Description | Elevated expression of miR-613 increased the sensitivity of GC cells to cisplatin and suppressed GC cell proliferation and migration by targeting SOX9. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Liver cancer | [1] | |||
Resistant Disease | Liver cancer [ICD-11: 2C12.6] | |||
Resistant Drug | Sorafenib | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
SOX9 signaling pathway | Activation | hsa04024 | ||
In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
HCCLM3 cells | Liver | Homo sapiens (Human) | CVCL_6832 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | The drug sensitivity of HCC to sorafenib and cisplatin was significantly decreased when miR-613 was knockdown, suggesting that miR-613 played a possible role in the treatment of HCC drug resistance. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.