Molecule Information

General Information of the Molecule (ID: Mol01677)
Name
hsa-miR-613 ,Homo sapiens
Synonyms
microRNA 613
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AGGAAUGUUCCUUCUUUGCC
    Click to Show/Hide
Ensembl ID
ENSG00000207983
HGNC ID
HGNC:32869
Mature Accession
MIMAT0003281
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Liver cancer [ICD-11: 2C12.6] [1]
Resistant Disease Liver cancer [ICD-11: 2C12.6]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
SOX9 signaling pathway Activation hsa04024
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HCCLM3 cells Liver Homo sapiens (Human) CVCL_6832
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometry assay
Mechanism Description The drug sensitivity of HCC to sorafenib and cisplatin was significantly decreased when miR-613 was knockdown, suggesting that miR-613 played a possible role in the treatment of HCC drug resistance.
Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell viability Activation hsa05200
In Vitro Model MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
HGC27 cells Gastric Homo sapiens (Human) CVCL_1279
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Wound healing assay
Mechanism Description Elevated expression of miR-613 increased the sensitivity of GC cells to cisplatin and suppressed GC cell proliferation and migration by targeting SOX9.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [3]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance		 MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
Sorafenib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Liver cancer [ICD-11: 2C12.6] [1]
Resistant Disease Liver cancer [ICD-11: 2C12.6]
 Disease Info 
Resistant Drug Sorafenib
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
SOX9 signaling pathway Activation hsa04024
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HCCLM3 cells Liver Homo sapiens (Human) CVCL_6832
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometry assay
Mechanism Description The drug sensitivity of HCC to sorafenib and cisplatin was significantly decreased when miR-613 was knockdown, suggesting that miR-613 played a possible role in the treatment of HCC drug resistance.
Verapamil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [3]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Verapamil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance		 MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
References
Ref 1 miR-613 inhibits liver cancer stem cell expansion by regulating SOX9 pathway. Gene. 2019 Jul 30;707:78-85. doi: 10.1016/j.gene.2019.05.015. Epub 2019 May 7.
Ref 2 MicroRNA-613 induces the sensitivity of gastric cancer cells to cisplatin through targeting SOX9 expression. Am J Transl Res. 2019 Feb 15;11(2):885-894. eCollection 2019.
Ref 3 The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.