Molecule Information
General Information of the Molecule (ID: Mol01676)
Name |
hsa-miR-595
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 595
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
GAAGUGUGCCGUGGUGUGUCU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Ovarian cancer | [1] | |||
Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
HO8910 cells | Ovary | Homo sapiens (Human) | CVCL_6868 | |
ES2 cells | Ovary | Homo sapiens (Human) | CVCL_AX39 | |
FTE187 cells | Ovary | Homo sapiens (Human) | N.A. | |
HG-SOC cells | Ovary | Homo sapiens (Human) | N.A. | |
HO8910PM cells | Ovary | Homo sapiens (Human) | CVCL_0310 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | microRNA-595 sensitizes ovarian cancer cells to cisplatin by targeting ABCB1. The expression level of ABCB1 was inversely correlated with miR595 in the ovarian cancer tissues, overexpression of ABCB1 decreased the miR595-overexpressing HO8910PM and SkOV-3 cell sensitivity to cisplatin. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.