General Information of the Molecule (ID: Mol01676)
Name
hsa-miR-595 ,Homo sapiens
Synonyms
microRNA 595
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
GAAGUGUGCCGUGGUGUGUCU
    Click to Show/Hide
Ensembl ID
ENSG00000207637
HGNC ID
HGNC:32851
Mature Accession
MIMAT0003263
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
HO8910 cells Ovary Homo sapiens (Human) CVCL_6868
ES2 cells Ovary Homo sapiens (Human) CVCL_AX39
FTE187 cells Ovary Homo sapiens (Human) N.A.
HG-SOC cells Ovary Homo sapiens (Human) N.A.
HO8910PM cells Ovary Homo sapiens (Human) CVCL_0310
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description microRNA-595 sensitizes ovarian cancer cells to cisplatin by targeting ABCB1. The expression level of ABCB1 was inversely correlated with miR595 in the ovarian cancer tissues, overexpression of ABCB1 decreased the miR595-overexpressing HO8910PM and SkOV-3 cell sensitivity to cisplatin.
References
Ref 1 MicroRNA-595 sensitizes ovarian cancer cells to cisplatin by targeting ABCB1. Oncotarget. 2016 Dec 27;7(52):87091-87099. doi: 10.18632/oncotarget.13526.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.