Molecule Information

General Information of the Molecule (ID: Mol01672)

• Name: hsa-miR-582-5p ,Homo sapiens
• Synonyms: microRNA 582
• Molecule Type: Mature miRNA
• Sequence: UUACAGUUGUUCAACCAGUUACU
• Ensembl ID: ENSG00000202601
• HGNC ID: HGNC:32838
• Mature Accession: MIMAT0003247

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Testicular cancer [.] [1]

• Resistant Disease: Testicular cancer [.]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: RT-qPCR with "Low Density Array"
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Examining almost all known human micro-RNA species confirmed the miR-371-373 cluster as a promising target for explaining cisplatin resistance, potentially by counteracting wild-type P53 induced senescence or linking it with the potency to differentiate. Moreover, we describe for the first time an association of the up-regulation of micro-RNA species such as hsa-miR-512-3p/-515/-517/-518/-525 and down-regulation of hsa-miR-99a/-100/-145 with a cisplatin resistant phenotype in human germ cell tumors.

Sirolimus

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Bladder cancer [ICD-11: 2C94.0] [2]

• Resistant Disease: Bladder cancer [ICD-11: 2C94.0]
• Resistant Drug: Sirolimus
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: 5637 cells; Bladder; Homo sapiens (Human); CVCL_0126
• In Vitro Model: EJ cells; Bladder; Homo sapiens (Human); CVCL_UI82
• In Vitro Model: J82 cells; Bladder; Homo sapiens (Human); CVCL_0359
• In Vitro Model: SV-HUC-1 cells; Bladder; Homo sapiens (Human); CVCL_3798
• In Vitro Model: T24 cells; Bladder; Homo sapiens (Human); CVCL_0554
• In Vitro Model: HT1376 cells; Bladder; Homo sapiens (Human); CVCL_1292
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: UCA1 knockdown suppresses growth, migration, and invasion of T24 and 5637 cells via derepression of miR-582-5p and ATG7 was downregulated by UCA1 shRNA and upregulated by miR-582-5p inhibitor.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [3]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCT-8 cells; Colon; Homo sapiens (Human); CVCL_2478
• Experiment for Molecule Alteration: Whole-genome screens
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: This gene is up-regulated in vincristine-resistance cells

References

• Ref 1: Down-regulation of miR-27a might inhibit proliferation and drug resistance of gastric cancer cells. J Exp Clin Cancer Res. 2011 May 13;30(1):55. doi: 10.1186/1756-9966-30-55.
• Ref 2: Long noncoding RNA UCA1 targets miR-582-5p and contributes to the progression and drug resistance of bladder cancer cells through ATG7-mediated autophagy inhibition. Onco Targets Ther. 2019 Jan 9;12:495-508. doi: 10.2147/OTT.S183940. eCollection 2019.
• Ref 3: Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.