General Information of the Molecule (ID: Mol01672)
Name
hsa-miR-582-5p ,Homo sapiens
Synonyms
microRNA 582
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UUACAGUUGUUCAACCAGUUACU
    Click to Show/Hide
Ensembl ID
ENSG00000202601
HGNC ID
HGNC:32838
Mature Accession
MIMAT0003247
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Sirolimus
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [ICD-11: 2C94.0] [1]
Resistant Disease Bladder cancer [ICD-11: 2C94.0]
Resistant Drug Sirolimus
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Activation hsa05200
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
EJ cells Bladder Homo sapiens (Human) CVCL_UI82
J82 cells Bladder Homo sapiens (Human) CVCL_0359
SV-HUC-1 cells Bladder Homo sapiens (Human) CVCL_3798
T24 cells Bladder Homo sapiens (Human) CVCL_0554
HT1376 cells Bladder Homo sapiens (Human) CVCL_1292
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description UCA1 knockdown suppresses growth, migration, and invasion of T24 and 5637 cells via derepression of miR-582-5p and ATG7 was downregulated by UCA1 shRNA and upregulated by miR-582-5p inhibitor.
References
Ref 1 Long noncoding RNA UCA1 targets miR-582-5p and contributes to the progression and drug resistance of bladder cancer cells through ATG7-mediated autophagy inhibition. Onco Targets Ther. 2019 Jan 9;12:495-508. doi: 10.2147/OTT.S183940. eCollection 2019.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.