Molecule Information
General Information of the Molecule (ID: Mol01672)
Name |
hsa-miR-582-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 582
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UUACAGUUGUUCAACCAGUUACU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Bladder cancer | [1] | |||
Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
Resistant Drug | Sirolimus | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell viability | Activation | hsa05200 | |
In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
EJ cells | Bladder | Homo sapiens (Human) | CVCL_UI82 | |
J82 cells | Bladder | Homo sapiens (Human) | CVCL_0359 | |
SV-HUC-1 cells | Bladder | Homo sapiens (Human) | CVCL_3798 | |
T24 cells | Bladder | Homo sapiens (Human) | CVCL_0554 | |
HT1376 cells | Bladder | Homo sapiens (Human) | CVCL_1292 | |
In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | UCA1 knockdown suppresses growth, migration, and invasion of T24 and 5637 cells via derepression of miR-582-5p and ATG7 was downregulated by UCA1 shRNA and upregulated by miR-582-5p inhibitor. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.