Molecule Information
General Information of the Molecule (ID: Mol01670)
| Name |
hsa-miR-574-3p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 574
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
CACGCUCAUGCACACACCCACA
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric carcinoma [ICD-11: 2B72.Z] | [1] | |||
| Sensitive Disease | Gastric carcinoma [ICD-11: 2B72.Z] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | microRNA-574-3p regulates epithelial mesenchymal transition and cisplatin resistance via targeting ZEB1 in human gastric carcinoma cells. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [2] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Tamoxifen | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| T47D cells | Breast | Homo sapiens (Human) | CVCL_0553 | |
| 293T cells | Breast | Homo sapiens (Human) | CVCL_0063 | |
| Experiment for Molecule Alteration |
qPCR; qRT-PCR | |||
| Experiment for Drug Resistance |
MTS or WST-8 assay | |||
| Mechanism Description | Loss and gain of miR-574-3p function in MCF-7 cells causes CLTC to be upregulated and downregulated, respectively. And CLTC siRNA knockdown restores tamoxifen sensitivity, and low CLTC levels are correlated with better survival in tamoxifen-treated breast cancer patients. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
