General Information of the Molecule (ID: Mol01670)
Name
hsa-miR-574-3p ,Homo sapiens
Synonyms
microRNA 574
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
CACGCUCAUGCACACACCCACA
    Click to Show/Hide
Ensembl ID
ENSG00000207944
HGNC ID
HGNC:32830
Mature Accession
MIMAT0003239
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric carcinoma [ICD-11: 2B72.Z] [1]
Sensitive Disease Gastric carcinoma [ICD-11: 2B72.Z]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description microRNA-574-3p regulates epithelial mesenchymal transition and cisplatin resistance via targeting ZEB1 in human gastric carcinoma cells.
Tamoxifen
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [2]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Tamoxifen
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
T47D cells Breast Homo sapiens (Human) CVCL_0553
293T cells Breast Homo sapiens (Human) CVCL_0063
Experiment for
Molecule Alteration
qPCR; qRT-PCR
Experiment for
Drug Resistance
MTS or WST-8 assay
Mechanism Description Loss and gain of miR-574-3p function in MCF-7 cells causes CLTC to be upregulated and downregulated, respectively. And CLTC siRNA knockdown restores tamoxifen sensitivity, and low CLTC levels are correlated with better survival in tamoxifen-treated breast cancer patients.
References
Ref 1 MicroRNA-574-3p regulates epithelial mesenchymal transition and cisplatin resistance via targeting ZEB1 in human gastric carcinoma cells. Gene. 2019 Jun 5;700:110-119. doi: 10.1016/j.gene.2019.03.043. Epub 2019 Mar 24.
Ref 2 MicroRNA-574-3p, identified by microRNA library-based functional screening, modulates tamoxifen response in breast cancer. Sci Rep. 2015 Jan 6;5:7641. doi: 10.1038/srep07641.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.