Molecule Information
General Information of the Molecule (ID: Mol01669)
Name |
hsa-miR-299-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 299
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UGGUUUACCGUCCCACAUACAU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Glioblastoma | [1] | |||
Sensitive Disease | Glioblastoma [ICD-11: 2A00.02] | |||
Sensitive Drug | Temozolomide | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell growth | Inhibition | hsa05200 | |
MAPK/ERK signaling pathway | Inhibition | hsa04010 | ||
In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
A172 cells | Brain | Homo sapiens (Human) | CVCL_0131 | |
SNB19 cells | Brain | Homo sapiens (Human) | CVCL_0535 | |
T98G cells | Brain | Homo sapiens (Human) | CVCL_0556 | |
LN308 cells | Brain | Homo sapiens (Human) | CVCL_0394 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | Inhibition of microRNA-299-5p sensitizes glioblastoma cells to temozolomide via upregulating GOLPH3 and inactivating the MAPk/ERk signaling pathway. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.