General Information of the Molecule (ID: Mol01669)
Name
hsa-miR-299-5p ,Homo sapiens
Synonyms
microRNA 299
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGGUUUACCGUCCCACAUACAU
    Click to Show/Hide
Ensembl ID
ENSG00000207749
HGNC ID
HGNC:31618
Mature Accession
MIMAT0002890
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Temozolomide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [ICD-11: 2A00.02] [1]
Sensitive Disease Glioblastoma [ICD-11: 2A00.02]
Sensitive Drug Temozolomide
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell growth Inhibition hsa05200
MAPK/ERK signaling pathway Inhibition hsa04010
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
A172 cells Brain Homo sapiens (Human) CVCL_0131
SNB19 cells Brain Homo sapiens (Human) CVCL_0535
T98G cells Brain Homo sapiens (Human) CVCL_0556
LN308 cells Brain Homo sapiens (Human) CVCL_0394
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description Inhibition of microRNA-299-5p sensitizes glioblastoma cells to temozolomide via upregulating GOLPH3 and inactivating the MAPk/ERk signaling pathway.
References
Ref 1 Inhibition of microRNA-299-5p sensitizes glioblastoma cells to temozolomide via the MAPK/ERK signaling pathway. Biosci Rep. 2018 Sep 12;38(5):BSR20181051. doi: 10.1042/BSR20181051. Print 2018 Oct 31.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.