Molecule Information
General Information of the Molecule (ID: Mol01669)
| Name |
hsa-miR-299-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 299
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UGGUUUACCGUCCCACAUACAU
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioblastoma [ICD-11: 2A00.02] | [1] | |||
| Sensitive Disease | Glioblastoma [ICD-11: 2A00.02] | |||
| Sensitive Drug | Temozolomide | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell growth | Inhibition | hsa05200 | |
| MAPK/ERK signaling pathway | Inhibition | hsa04010 | ||
| In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
| A172 cells | Brain | Homo sapiens (Human) | CVCL_0131 | |
| SNB19 cells | Brain | Homo sapiens (Human) | CVCL_0535 | |
| T98G cells | Brain | Homo sapiens (Human) | CVCL_0556 | |
| LN308 cells | Brain | Homo sapiens (Human) | CVCL_0394 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | Inhibition of microRNA-299-5p sensitizes glioblastoma cells to temozolomide via upregulating GOLPH3 and inactivating the MAPk/ERk signaling pathway. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
