Molecule Information

General Information of the Molecule (ID: Mol01669)

• Name: hsa-miR-299-5p ,Homo sapiens
• Synonyms: microRNA 299
• Molecule Type: Mature miRNA
• Sequence: UGGUUUACCGUCCCACAUACAU
• Ensembl ID: ENSG00000207749
• HGNC ID: HGNC:31618
• Mature Accession: MIMAT0002890

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [1]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell growth; Inhibition; hsa05200
• Cell Pathway Regulation: MAPK/ERK signaling pathway; Inhibition; hsa04010
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: A172 cells; Brain; Homo sapiens (Human); CVCL_0131
• In Vitro Model: SNB19 cells; Brain; Homo sapiens (Human); CVCL_0535
• In Vitro Model: T98G cells; Brain; Homo sapiens (Human); CVCL_0556
• In Vitro Model: LN308 cells; Brain; Homo sapiens (Human); CVCL_0394
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: Inhibition of microRNA-299-5p sensitizes glioblastoma cells to temozolomide via upregulating GOLPH3 and inactivating the MAPk/ERk signaling pathway.

References

• Ref 1: Inhibition of microRNA-299-5p sensitizes glioblastoma cells to temozolomide via the MAPK/ERK signaling pathway. Biosci Rep. 2018 Sep 12;38(5):BSR20181051. doi: 10.1042/BSR20181051. Print 2018 Oct 31.