Molecule Information
General Information of the Molecule (ID: Mol01668)
Name |
hsa-miR-509-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 509-1
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UGAUUGGUACGUCUGUGGGUAG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Ovarian cancer | [1] | |||
Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell viability | Activation | hsa05200 | |
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
HEK293A cells | Kideny | Homo sapiens (Human) | CVCL_6910 | |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | miR-509-3p expression significantly decreased in patients with platinum-resistance and up-regulation of GOLPH3 and WLS gene expression was observer when cells were transfected with miR-509-3p inhibitor. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Ovarian cancer | [2] | |||
Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
HEK293T cells | Kidney | Homo sapiens (Human) | CVCL_0063 | |
OVCAR3 cells | Ovary | Homo sapiens (Human) | CVCL_0465 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT and DAPI assays | |||
Mechanism Description | miR509-3p could sensitize ovarian cancer cells to cisplatin treatment by targeting multiple anti-apoptosis genes including BCL2 and promoteing apoptosis in cancer cells. | |||
Disease Class: Epithelial ovarian cancer | [3] | |||
Sensitive Disease | Epithelial ovarian cancer [ICD-11: 2B5D.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Overexpression of miR-509-3p can not only downregulate the expression of XIAP in ovarian cancer cells but also inhibit the proliferation of EOC cells and increase their sensitivity to cisplatin-induced apoptosis. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.