Molecule Information

General Information of the Molecule (ID: Mol01668)

• Name: hsa-miR-509-3p ,Homo sapiens
• Synonyms: microRNA 509-1
• Molecule Type: Mature miRNA
• Sequence: UGAUUGGUACGUCUGUGGGUAG
• Ensembl ID: ENSG00000208000
• HGNC ID: HGNC:32146
• Mature Accession: MIMAT0002881

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: HEK293A cells; Kideny; Homo sapiens (Human); CVCL_6910
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-509-3p expression significantly decreased in patients with platinum-resistance and up-regulation of GOLPH3 and WLS gene expression was observer when cells were transfected with miR-509-3p inhibitor.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [2]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT and DAPI assays
• Mechanism Description: miR509-3p could sensitize ovarian cancer cells to cisplatin treatment by targeting multiple anti-apoptosis genes including BCL2 and promoteing apoptosis in cancer cells.

Disease Class: Epithelial ovarian cancer [3]

• Sensitive Disease: Epithelial ovarian cancer [ICD-11: 2B5D.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of miR-509-3p can not only downregulate the expression of XIAP in ovarian cancer cells but also inhibit the proliferation of EOC cells and increase their sensitivity to cisplatin-induced apoptosis.

References

• Ref 1: miR-509-3p enhances platinum drug sensitivity in ovarian cancer. Gene. 2019 Feb 20;686:63-67. doi: 10.1016/j.gene.2018.11.011. Epub 2018 Nov 5.
• Ref 2: miR-509-3p promotes cisplatin-induced apoptosis in ovarian cancer cells through the regulation of anti-apoptotic genes. Pharmacogenomics. 2017 Dec;18(18):1671-1682. doi: 10.2217/pgs-2017-0115. Epub 2017 Nov 27.
• Ref 3: MicroRNA-509-3p increases the sensitivity of epithelial ovarian cancer cells to cisplatin-induced apoptosis. Pharmacogenomics. 2016 Feb;17(3):187-97. doi: 10.2217/pgs.15.166. Epub 2016 Jan 20.