General Information of the Molecule (ID: Mol01668)
Name
hsa-miR-509-3p ,Homo sapiens
Synonyms
microRNA 509-1
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGAUUGGUACGUCUGUGGGUAG
    Click to Show/Hide
Ensembl ID
ENSG00000208000
HGNC ID
HGNC:32146
Mature Accession
MIMAT0002881
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [1]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell viability Activation hsa05200
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
HEK293A cells Kideny Homo sapiens (Human) CVCL_6910
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-509-3p expression significantly decreased in patients with platinum-resistance and up-regulation of GOLPH3 and WLS gene expression was observer when cells were transfected with miR-509-3p inhibitor.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [2]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
HEK293T cells Kidney Homo sapiens (Human) CVCL_0063
OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT and DAPI assays
Mechanism Description miR509-3p could sensitize ovarian cancer cells to cisplatin treatment by targeting multiple anti-apoptosis genes including BCL2 and promoteing apoptosis in cancer cells.
Disease Class: Epithelial ovarian cancer [3]
Sensitive Disease Epithelial ovarian cancer [ICD-11: 2B5D.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Overexpression of miR-509-3p can not only downregulate the expression of XIAP in ovarian cancer cells but also inhibit the proliferation of EOC cells and increase their sensitivity to cisplatin-induced apoptosis.
References
Ref 1 miR-509-3p enhances platinum drug sensitivity in ovarian cancer. Gene. 2019 Feb 20;686:63-67. doi: 10.1016/j.gene.2018.11.011. Epub 2018 Nov 5.
Ref 2 miR-509-3p promotes cisplatin-induced apoptosis in ovarian cancer cells through the regulation of anti-apoptotic genes. Pharmacogenomics. 2017 Dec;18(18):1671-1682. doi: 10.2217/pgs-2017-0115. Epub 2017 Nov 27.
Ref 3 MicroRNA-509-3p increases the sensitivity of epithelial ovarian cancer cells to cisplatin-induced apoptosis. Pharmacogenomics. 2016 Feb;17(3):187-97. doi: 10.2217/pgs.15.166. Epub 2016 Jan 20.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.