General Information of the Molecule (ID: Mol01666)
Name
hsa-miR-503-5p ,Homo sapiens
Synonyms
microRNA 503
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UAGCAGCGGGAACAGUUCUGCAG
    Click to Show/Hide
Ensembl ID
ENSG00000208005
HGNC ID
HGNC:32138
Mature Accession
MIMAT0002874
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Oxaliplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal carcinoma [ICD-11: 2B91.3] [1]
Sensitive Disease Colorectal carcinoma [ICD-11: 2B91.3]
Sensitive Drug Oxaliplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation P53/PUMA signaling pathway Activation hsa04115
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
TUNEL and ki67 staining; Caspase-3 activity assay; MTT assay
Mechanism Description miR503-5p induces oxaliplatin resistance through the inhibition of apoptosis by reducing PUMA expression, which could direct target by miR503-5p. P53 suppresses miR503-5p expression.
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
PLX4720
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Papillary thyroid carcinoma [ICD-11: 2D10.1] [2]
Resistant Disease Papillary thyroid carcinoma [ICD-11: 2D10.1]
Resistant Drug PLX4720
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Experiment for
Molecule Alteration
Immunoblot analysis; qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description This gene is down-regulated in PLX4720-resistance cells
References
Ref 1 miR-503-5p confers drug resistance by targeting PUMA in colorectal carcinoma. Oncotarget. 2017 Mar 28;8(13):21719-21732. doi: 10.18632/oncotarget.15559.
Ref 2 Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.