Molecule Information
General Information of the Molecule (ID: Mol01666)
| Name |
hsa-miR-503-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 503
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UAGCAGCGGGAACAGUUCUGCAG
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal carcinoma [ICD-11: 2B91.3] | [1] | |||
| Sensitive Disease | Colorectal carcinoma [ICD-11: 2B91.3] | |||
| Sensitive Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | P53/PUMA signaling pathway | Activation | hsa04115 | |
| In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
| HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
TUNEL and ki67 staining; Caspase-3 activity assay; MTT assay | |||
| Mechanism Description | miR503-5p induces oxaliplatin resistance through the inhibition of apoptosis by reducing PUMA expression, which could direct target by miR503-5p. P53 suppresses miR503-5p expression. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
