Molecule Information

General Information of the Molecule (ID: Mol01666)

• Name: hsa-miR-503-5p ,Homo sapiens
• Synonyms: microRNA 503
• Molecule Type: Mature miRNA
• Sequence: UAGCAGCGGGAACAGUUCUGCAG
• Ensembl ID: ENSG00000208005
• HGNC ID: HGNC:32138
• Mature Accession: MIMAT0002874

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Oxaliplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal carcinoma [1]

• Sensitive Disease: Colorectal carcinoma [ICD-11: 2B91.3]
• Sensitive Drug: Oxaliplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: P53/PUMA signaling pathway; Activation; hsa04115
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: TUNEL and ki67 staining; Caspase-3 activity assay; MTT assay
• Mechanism Description: miR503-5p induces oxaliplatin resistance through the inhibition of apoptosis by reducing PUMA expression, which could direct target by miR503-5p. P53 suppresses miR503-5p expression.

References

• Ref 1: miR-503-5p confers drug resistance by targeting PUMA in colorectal carcinoma. Oncotarget. 2017 Mar 28;8(13):21719-21732. doi: 10.18632/oncotarget.15559.