Molecule Information
General Information of the Molecule (ID: Mol01664)
Name |
hsa-miR-524-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 524
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
CUACAAAGGGAAGCACUUUCUC
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [1] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | AGS cells | Gastric | Homo sapiens (Human) | CVCL_0139 |
AZ521 cells | Gastric | Homo sapiens (Human) | CVCL_2862 | |
SC-M1 cells | Gastric | Homo sapiens (Human) | CVCL_G299 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Transwell cell migration assay | |||
Mechanism Description | Upregulation of microRNA-524-5p enhances the cisplatin sensitivity of gastric cancer cells by modulating proliferation and metastasis via targeting SOX9, SOX9 overexpression could counteracts the chemosensitizing effects of miR524-5p. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.