Molecule Information

General Information of the Molecule (ID: Mol01664)

• Name: hsa-miR-524-5p ,Homo sapiens
• Synonyms: microRNA 524
• Molecule Type: Mature miRNA
• Sequence: CUACAAAGGGAAGCACUUUCUC
• Ensembl ID: ENSG00000283289
• HGNC ID: HGNC:32110
• Mature Accession: MIMAT0002849

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vitro Model: AZ521 cells; Gastric; Homo sapiens (Human); CVCL_2862
• In Vitro Model: SC-M1 cells; Gastric; Homo sapiens (Human); CVCL_G299
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Transwell cell migration assay
• Mechanism Description: Upregulation of microRNA-524-5p enhances the cisplatin sensitivity of gastric cancer cells by modulating proliferation and metastasis via targeting SOX9, SOX9 overexpression could counteracts the chemosensitizing effects of miR524-5p.

References

• Ref 1: Upregulation of microRNA-524-5p enhances the cisplatin sensitivity of gastric cancer cells by modulating proliferation and metastasis via targeting SOX9. Oncotarget. 2017 Jan 3;8(1):574-582. doi: 10.18632/oncotarget.13479.