Molecule Information
General Information of the Molecule (ID: Mol01660)
| Name |
hsa-miR-494-3p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 494
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UGAAACAUACACGGGAAACCUC
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] | [1] | |||
| Resistant Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
| Resistant Drug | Dasatinib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | Lin-CD34+CD38- cells | Bone | Homo sapiens (Human) | N.A. |
| Lin-CD34-CD38- CML cells | Bone | Homo sapiens (Human) | N.A. | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Annexin V assay | |||
| Mechanism Description | miR494-3p down-regulation in CML LSCs, leading to c-MYC up-regulation, was able to decrease TkI-induced apoptosis. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] | [1] | |||
| Resistant Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
| Resistant Drug | Imatinib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | Lin-CD34+CD38- cells | Bone | Homo sapiens (Human) | N.A. |
| Lin-CD34-CD38- CML cells | Bone | Homo sapiens (Human) | N.A. | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Annexin V assay | |||
| Mechanism Description | miR494-3p down-regulation in CML LSCs, leading to c-MYC up-regulation, was able to decrease TkI-induced apoptosis. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] | [1] | |||
| Resistant Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
| Resistant Drug | Ponatinib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | Lin-CD34+CD38- cells | Bone | Homo sapiens (Human) | N.A. |
| Lin-CD34-CD38- CML cells | Bone | Homo sapiens (Human) | N.A. | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Annexin V assay | |||
| Mechanism Description | miR494-3p down-regulation in CML LSCs, leading to c-MYC up-regulation, was able to decrease TkI-induced apoptosis. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
