General Information of the Molecule (ID: Mol01660)
Name
hsa-miR-494-3p ,Homo sapiens
Synonyms
microRNA 494
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGAAACAUACACGGGAAACCUC
    Click to Show/Hide
Ensembl ID
ENSG00000194717
HGNC ID
HGNC:32084
Mature Accession
MIMAT0002816
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Dasatinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [1]
Resistant Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
Resistant Drug Dasatinib
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model Lin-CD34+CD38- cells Bone Homo sapiens (Human) N.A.
Lin-CD34-CD38- CML cells Bone Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Annexin V assay
Mechanism Description miR494-3p down-regulation in CML LSCs, leading to c-MYC up-regulation, was able to decrease TkI-induced apoptosis.
Imatinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [1]
Resistant Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
Resistant Drug Imatinib
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model Lin-CD34+CD38- cells Bone Homo sapiens (Human) N.A.
Lin-CD34-CD38- CML cells Bone Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Annexin V assay
Mechanism Description miR494-3p down-regulation in CML LSCs, leading to c-MYC up-regulation, was able to decrease TkI-induced apoptosis.
Ponatinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [1]
Resistant Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
Resistant Drug Ponatinib
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model Lin-CD34+CD38- cells Bone Homo sapiens (Human) N.A.
Lin-CD34-CD38- CML cells Bone Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Annexin V assay
Mechanism Description miR494-3p down-regulation in CML LSCs, leading to c-MYC up-regulation, was able to decrease TkI-induced apoptosis.
References
Ref 1 Deregulated expression of miR-29a-3p, miR-494-3p and miR-660-5p affects sensitivity to tyrosine kinase inhibitors in CML leukemic stem cells. Oncotarget. 2017 Jul 25;8(30):49451-49469. doi: 10.18632/oncotarget.17706.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.