General Information of the Molecule (ID: Mol01658)
Name
hsa-miR-490-3p ,Homo sapiens
Synonyms
microRNA 490
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
CAACCUGGAGGACUCCAUGCUG
    Click to Show/Hide
Ensembl ID
ENSG00000207597
HGNC ID
HGNC:32075
Mature Accession
MIMAT0002806
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [1]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
OVCAR3/CDDP cells Ovary Homo sapiens (Human) CVCL_0465
SkOV3/CDDP cells Ovary Homo sapiens (Human) CVCL_D622
In Vivo Model Mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR490-3p sensitizes ovarian cancer cells to cisplatin by directly targeting ABCC2. miR490-3p enhances CDDP sensitivity of ovarian cancer cells through downregulating ABCC2 expression.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [2]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model A2780 cells Ovary Homo sapiens (Human) CVCL_0134
Experiment for
Molecule Alteration
Western blot analysis
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description microRNA 490-3P was involved in the development of drug resistance through regulating MDR1/P-gp and GST-Pi expression in ovarian cancer cells.
References
Ref 1 MiR-490-3p sensitizes ovarian cancer cells to cisplatin by directly targeting ABCC2. Am J Transl Res. 2017 Mar 15;9(3):1127-1138. eCollection 2017.
Ref 2 microRNA 490-3P enhances the drug-resistance of human ovarian cancer cells. J Ovarian Res. 2014 Aug 31;7:84. doi: 10.1186/s13048-014-0084-4.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.