Molecule Information

General Information of the Molecule (ID: Mol01651)

• Name: hsa-miR-451a ,Homo sapiens
• Synonyms: microRNA 451a
• Molecule Type: Mature miRNA
• Sequence: AAACCGUUACCAUUACUGAGUU
• Ensembl ID: ENSG00000284565
• HGNC ID: HGNC:32053
• Mature Accession: MIMAT0001631

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Tamoxifen

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: AKT/mTOR signaling pathway; Regulation; hsa04150
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: LCC2 cells; Breast; Homo sapiens (Human); CVCL_DP51
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Over-expression of miR-451a can enhance MCF-7 and LCC2 cell sensitivity to TAM. Opposite effects were elicited by knocking down miR-451a. TAM treatment can up-regulate 14-3-3Zeta expression, and down-regulate ERalpha expression. 14-3-3Zeta and ERalpha were shown to interact. Over-expression of miR-451a decreased 14-3-3Zeta expression and increased ERalpha expression, suppressing cell proliferation, increasing apoptosis, and reducing activation of p-AkT and p-mTOR.

References

• Ref 1: Over-expression of miR-451a can enhance the sensitivity of breast cancer cells to tamoxifen by regulating 14-3-3 Zeta, estrogen receptor Alpha, and autophagy. Life Sci. 2016 Mar 15;149:104-13. doi: 10.1016/j.lfs.2016.02.059. Epub 2016 Feb 17.