Molecule Information
General Information of the Molecule (ID: Mol01651)
Name |
hsa-miR-451a
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 451a
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
AAACCGUUACCAUUACUGAGUU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [1] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Tamoxifen | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | AKT/mTOR signaling pathway | Regulation | hsa04150 | |
Cell apoptosis | Activation | hsa04210 | ||
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
LCC2 cells | Breast | Homo sapiens (Human) | CVCL_DP51 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Over-expression of miR-451a can enhance MCF-7 and LCC2 cell sensitivity to TAM. Opposite effects were elicited by knocking down miR-451a. TAM treatment can up-regulate 14-3-3Zeta expression, and down-regulate ERalpha expression. 14-3-3Zeta and ERalpha were shown to interact. Over-expression of miR-451a decreased 14-3-3Zeta expression and increased ERalpha expression, suppressing cell proliferation, increasing apoptosis, and reducing activation of p-AkT and p-mTOR. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.