General Information of the Molecule (ID: Mol01651)
Name
hsa-miR-451a ,Homo sapiens
Synonyms
microRNA 451a
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AAACCGUUACCAUUACUGAGUU
    Click to Show/Hide
Ensembl ID
ENSG00000284565
HGNC ID
HGNC:32053
Mature Accession
MIMAT0001631
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Tamoxifen
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [1]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Tamoxifen
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation AKT/mTOR signaling pathway Regulation hsa04150
Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
LCC2 cells Breast Homo sapiens (Human) CVCL_DP51
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Over-expression of miR-451a can enhance MCF-7 and LCC2 cell sensitivity to TAM. Opposite effects were elicited by knocking down miR-451a. TAM treatment can up-regulate 14-3-3Zeta expression, and down-regulate ERalpha expression. 14-3-3Zeta and ERalpha were shown to interact. Over-expression of miR-451a decreased 14-3-3Zeta expression and increased ERalpha expression, suppressing cell proliferation, increasing apoptosis, and reducing activation of p-AkT and p-mTOR.
References
Ref 1 Over-expression of miR-451a can enhance the sensitivity of breast cancer cells to tamoxifen by regulating 14-3-3 Zeta, estrogen receptor Alpha, and autophagy. Life Sci. 2016 Mar 15;149:104-13. doi: 10.1016/j.lfs.2016.02.059. Epub 2016 Feb 17.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.