Molecule Information

General Information of the Molecule (ID: Mol01651)

• Name: hsa-miR-451a ,Homo sapiens
• Synonyms: microRNA 451a
• Molecule Type: Mature miRNA
• Sequence: AAACCGUUACCAUUACUGAGUU
• Ensembl ID: ENSG00000284565
• HGNC ID: HGNC:32053
• Mature Accession: MIMAT0001631

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 7 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K-AKT; Regulation; N.A.
• In Vitro Model: A2780CIS cells; Ovary; Homo sapiens (Human); CVCL_1942
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• Experiment for Molecule Alteration: PCR array and qPCR
• Mechanism Description: The current work demonstrates that Nine miRNAs were found to be upregulated in cells resistant to cisplatin. Clearly, these miRNAs have functions in cell death/survival related processes and treatment response. They may also target pathways involved in treatment response like PI3K-Akt, pathway in cancer and MAPK. Interestingly, High expression of hsa-miR-133b, hsa-miR-512-are, hsa-miR-200b-3p, and hsa-miR-451a is related to poor overall survival in patients diagnosed with ovarian cancer. Our findings suggest that hsa-miR-133b, hsa-miR-512-5p, hsa-miR-200b-3p, and hsa-miR-451a are good candidates for future studies aimed to establishing functional links and exploring therapeutic interventions to overcome cisplatin resistance.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Mechanism Description: Five miRNAs were selected for validation, all of which (miR-100, miR-17, miR-222, miR-342-3p and miR-451) were elevated in both A/exo and D/exo.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Cells viability and apoptosis assays
• Mechanism Description: Results:We identified 11 specific deregulated miRNAs, including 5 up-regulated miRNAs (miR-155-5p, miR-21-3p, miR-181a-5p, miR-181b-5p, and miR-183-5p) and 6 down-regulated miRNAs (miR-10b-5p, miR-451a, miR-125b-5p, miR-31-5p, miR-195-5p and miR-130a-3p)

Hydroxyurea

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Neuroblastoma [ICD-11: 2A00.02] [3]

• Resistant Disease: Neuroblastoma [ICD-11: 2A00.02]
• Resistant Drug: Hydroxyurea
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A2780DX5 cells; Ovary; Homo sapiens (Human); CVCL_4T98
• Experiment for Molecule Alteration: MiRNA microarray profiling
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: We report here that microRNAs miR-27a and miR-451 are involved in activating the expression of P-glycoprotein, the MDR1 gene product that confers cancer cell resistance to a broad range of chemotherapeutics. We showed that expressions of miR-27a and miR-451 were up-regulated in multidrug resistant (MDR) cancer cell lines A2780DX5 and KB-V1, as compared with their parental lines A2780 and KB-3-1. Treatment of A2780DX5 cells with the antagomirs of miR-27a or miR-451 decreased the expression of P-glycoprotein and MDR1 mRNA. In contrast, the mimics of miR-27a and miR-451 increased MDR1 expression in the parental cells A2780.

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [4]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: cMyc/miR-144/451; Regulation; N.A.
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• Experiment for Molecule Alteration: RT-qPCR; immunoprecipitation
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: In this study, we first found that c-myc expression is upregulated in imatinib resistant K562R cells, which in turn enhances the expression of miR-144/451. Knockdown of c-myc or restoration of miR-144/451 in the K562R cells sensitizes K562R cells to imatinib therapy. Our study here reveals an regulatory pathway between myc and miR-144/451 and highlights that targeting either myc or miR-144/451 might be valuable for eliminating the imatinib resistant CML cells.

Tamoxifen

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [5]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: AKT/mTOR signaling pathway; Regulation; N.A.
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: LCC2 cells; Breast; Homo sapiens (Human); CVCL_DP51
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Over-expression of miR-451a can enhance MCF-7 and LCC2 cell sensitivity to TAM. Opposite effects were elicited by knocking down miR-451a. TAM treatment can up-regulate 14-3-3Zeta expression, and down-regulate ERalpha expression. 14-3-3Zeta and ERalpha were shown to interact. Over-expression of miR-451a decreased 14-3-3Zeta expression and increased ERalpha expression, suppressing cell proliferation, increasing apoptosis, and reducing activation of p-AkT and p-mTOR.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [6]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

References

• Ref 1: MicroRNA-212-3p inhibits paclitaxel resistance through regulating epithelial-mesenchymal transition, migration and invasion by targeting ZEB2 in human hepatocellular carcinoma. Oncol Lett. 2020 Oct 20(4):23
• Ref 2: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 3: Identification of rifampin-resistant genotypes in Mycobacterium tuberculosis by PCR-reverse dot blot hybridization. Mol Biotechnol. 2009 Jan;41(1):1-7. doi: 10.1007/s12033-008-9085-0. Epub 2008 Jul 4.
• Ref 4: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
• Ref 5: Over-expression of miR-451a can enhance the sensitivity of breast cancer cells to tamoxifen by regulating 14-3-3 Zeta, estrogen receptor Alpha, and autophagy. Life Sci. 2016 Mar 15;149:104-13. doi: 10.1016/j.lfs.2016.02.059. Epub 2016 Feb 17.
• Ref 6: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.