Molecule Information

General Information of the Molecule (ID: Mol01650)

• Name: hsa-miR-433-3p ,Homo sapiens
• Synonyms: microRNA 433
• Molecule Type: Mature miRNA
• Sequence: AUCAUGAUGGGCUCCUCGGUGU
• Ensembl ID: ENSG00000207569
• HGNC ID: HGNC:32026
• Mature Accession: MIMAT0001627

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioma [1]

• Sensitive Disease: Glioma [ICD-11: 2A00.1]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: LN229 cells; Brain; Homo sapiens (Human); CVCL_0393
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• In Vitro Model: SNB19 cells; Brain; Homo sapiens (Human); CVCL_0535
• In Vitro Model: LN308 cells; Brain; Homo sapiens (Human); CVCL_0394
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Transwell migration assay; Annexin V/fluorescein isothiocyanate (FITC) apoptosis assay
• Mechanism Description: miR433-3p suppresses cell growth and enhances chemosensitivity by targeting CREB in human glioma, the overexpression of CREB can rescue the phenotype changes induced by miR433-3p overexpression.

References

• Ref 1: MiR-433-3p suppresses cell growth and enhances chemosensitivity by targeting CREB in human glioma. Oncotarget. 2017 Jan 17;8(3):5057-5068. doi: 10.18632/oncotarget.13789.