General Information of the Molecule (ID: Mol01650)
Name
hsa-miR-433-3p ,Homo sapiens
Synonyms
microRNA 433
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AUCAUGAUGGGCUCCUCGGUGU
    Click to Show/Hide
Ensembl ID
ENSG00000207569
HGNC ID
HGNC:32026
Mature Accession
MIMAT0001627
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Temozolomide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioma [ICD-11: 2A00.1] [1]
Sensitive Disease Glioma [ICD-11: 2A00.1]
Sensitive Drug Temozolomide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
LN229 cells Brain Homo sapiens (Human) CVCL_0393
U87 cells Brain Homo sapiens (Human) CVCL_0022
SNB19 cells Brain Homo sapiens (Human) CVCL_0535
LN308 cells Brain Homo sapiens (Human) CVCL_0394
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; Transwell migration assay; Annexin V/fluorescein isothiocyanate (FITC) apoptosis assay
Mechanism Description miR433-3p suppresses cell growth and enhances chemosensitivity by targeting CREB in human glioma, the overexpression of CREB can rescue the phenotype changes induced by miR433-3p overexpression.
References
Ref 1 MiR-433-3p suppresses cell growth and enhances chemosensitivity by targeting CREB in human glioma. Oncotarget. 2017 Jan 17;8(3):5057-5068. doi: 10.18632/oncotarget.13789.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.