Molecule Information
General Information of the Molecule (ID: Mol01650)
| Name |
hsa-miR-433-3p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 433
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
AUCAUGAUGGGCUCCUCGGUGU
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioma [ICD-11: 2A00.1] | [1] | |||
| Sensitive Disease | Glioma [ICD-11: 2A00.1] | |||
| Sensitive Drug | Temozolomide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
| LN229 cells | Brain | Homo sapiens (Human) | CVCL_0393 | |
| U87 cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
| SNB19 cells | Brain | Homo sapiens (Human) | CVCL_0535 | |
| LN308 cells | Brain | Homo sapiens (Human) | CVCL_0394 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Transwell migration assay; Annexin V/fluorescein isothiocyanate (FITC) apoptosis assay | |||
| Mechanism Description | miR433-3p suppresses cell growth and enhances chemosensitivity by targeting CREB in human glioma, the overexpression of CREB can rescue the phenotype changes induced by miR433-3p overexpression. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
