General Information of the Molecule (ID: Mol01649)
Name
hsa-miR-449a ,Homo sapiens
Synonyms
microRNA 449a
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGGCAGUGUAUUGUUAGCUGGU
    Click to Show/Hide
Ensembl ID
ENSG00000198983
HGNC ID
HGNC:27645
Mature Accession
MIMAT0001541
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [1]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
Notch signaling pathway Inhibition hsa04330
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
WST-8 dye assay; Flow cytometry assay
Mechanism Description miR-449a was involved in cisplatin resistance and the overexpression of miR449a increased cisplatin sensitivity mainly through inhibiting proliferation and promoting apoptosis and the direct downregulating the expression of NOTCH1.
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [2]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Tamoxifen
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell viability Activation hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
T47D cells Breast Homo sapiens (Human) CVCL_0553
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Decreased miR-449a causes the upregulation of ADAM22, which induces tamoxifen resistance of breast cancer cells.
References
Ref 1 MicroRNA-449a reduces cell survival and enhances cisplatin-induced cytotoxicity via downregulation of NOTCH1 in ovarian cancer cells. Tumour Biol. 2014 Dec;35(12):12369-78. doi: 10.1007/s13277-014-2551-3. Epub 2014 Sep 2.
Ref 2 miR-449a Suppresses Tamoxifen Resistance in Human Breast Cancer Cells by Targeting ADAM22. Cell Physiol Biochem. 2018;50(1):136-149. doi: 10.1159/000493964. Epub 2018 Oct 2.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.