Molecule Information
General Information of the Molecule (ID: Mol01647)
| Name |
hsa-miR-425-3p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 425
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
AUCGGGAAUGUCGUGUCCGCCC
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [1] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Sorafenib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell migration | Inhibition | hsa04670 | ||
| In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| HepG2 HCC cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
MTT assay; EdU assay | |||
| Mechanism Description | miR-425-3p levels were induced by sorafenib incubation in HuH-7 cells-derived exosomes, and this cell line was more sensitive to cell death after incubation with the drug. The involvement of extracellular vesicles in modulating HCC response to sorafenib has recently emerged providing a potential novel strategy to interfere with HCC chemoresistance. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
