Molecule Information

General Information of the Molecule (ID: Mol01640)

• Name: hsa-miR-324-5p ,Homo sapiens
• Synonyms: microRNA 324
• Molecule Type: Mature miRNA
• Sequence: CGCAUCCCCUAGGGCAUUGGUG
• Ensembl ID: ENSG00000199053
• HGNC ID: HGNC:31767
• Mature Accession: MIMAT0000761

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Bortezomib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Multiple myeloma [1]

• Sensitive Disease: Multiple myeloma [ICD-11: 2A83.0]
• Sensitive Drug: Bortezomib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Hedgehog signaling pathway; Inhibition; hsa04340
• In Vitro Model: NCI-H929 cells; Bone marrow; Homo sapiens (Human); CVCL_1600
• In Vitro Model: U266 cells; Bone marrow; Homo sapiens (Human); CVCL_0566
• In Vitro Model: RPMI-8226 cells; Peripheral blood; Homo sapiens (Human); CVCL_0014
• In Vitro Model: ARH-77 cells; Peripheral blood; Homo sapiens (Human); CVCL_1072
• In Vivo Model: Mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis; Colony formation assay
• Mechanism Description: Overexpression of miR324-5p significantly decreased Hh signaling components Smo and Gli1, and functionally reduced cell growth, survival as well as stem cell compartment in MM. miR324-5p potentiated the anti-MM efficacy of bortezomib through regulating the activities of multidrug-resistance proteins and the expression of Bcl-2 family genes. Down-regulation of miR324-5p is a novel mechanism of Hh signaling activation in MM.

References

• Ref 1: MicroRNA-324-5p regulates stemness, pathogenesis and sensitivity to bortezomib in multiple myeloma cells by targeting hedgehog signaling. Int J Cancer. 2018 Jan 1;142(1):109-120. doi: 10.1002/ijc.31041. Epub 2017 Sep 30.