General Information of the Molecule (ID: Mol01640)
Name
hsa-miR-324-5p ,Homo sapiens
Synonyms
microRNA 324
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
CGCAUCCCCUAGGGCAUUGGUG
    Click to Show/Hide
Ensembl ID
ENSG00000199053
HGNC ID
HGNC:31767
Mature Accession
MIMAT0000761
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Bortezomib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Multiple myeloma [ICD-11: 2A83.0] [1]
Sensitive Disease Multiple myeloma [ICD-11: 2A83.0]
Sensitive Drug Bortezomib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Hedgehog signaling pathway Inhibition hsa04340
In Vitro Model NCI-H929 cells Bone marrow Homo sapiens (Human) CVCL_1600
U266 cells Bone marrow Homo sapiens (Human) CVCL_0566
RPMI-8226 cells Peripheral blood Homo sapiens (Human) CVCL_0014
ARH-77 cells Peripheral blood Homo sapiens (Human) CVCL_1072
In Vivo Model Mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometric analysis; Colony formation assay
Mechanism Description Overexpression of miR324-5p significantly decreased Hh signaling components Smo and Gli1, and functionally reduced cell growth, survival as well as stem cell compartment in MM. miR324-5p potentiated the anti-MM efficacy of bortezomib through regulating the activities of multidrug-resistance proteins and the expression of Bcl-2 family genes. Down-regulation of miR324-5p is a novel mechanism of Hh signaling activation in MM.
References
Ref 1 MicroRNA-324-5p regulates stemness, pathogenesis and sensitivity to bortezomib in multiple myeloma cells by targeting hedgehog signaling. Int J Cancer. 2018 Jan 1;142(1):109-120. doi: 10.1002/ijc.31041. Epub 2017 Sep 30.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.