General Information of the Molecule (ID: Mol01638)
Name
hsa-miR-151a-3p ,Homo sapiens
Synonyms
microRNA 151a
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
CUAGACUGAAGCUCCUUGAGG
    Click to Show/Hide
Ensembl ID
ENSG00000254324
HGNC ID
HGNC:31762
Mature Accession
MIMAT0000757
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Temozolomide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Glioblastoma [1]
Resistant Disease Glioblastoma [ICD-11: 2A00.02]
Resistant Drug Temozolomide
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation DNA damage repair signaling pathway Activation hsa03410
miR151a-3p/XRCC4 signaling pathway Regulation hsa05206
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
LN229 cells Brain Homo sapiens (Human) CVCL_0393
A172 cells Brain Homo sapiens (Human) CVCL_0131
T98 cells Brain Homo sapiens (Human) CVCL_B368
U87 cells Brain Homo sapiens (Human) CVCL_0022
In Vivo Model Subcutaneous and orthotopic xenograft model Mus musculus
Experiment for
Molecule Alteration
RIP experiments; qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description Exosomal SBF2-AS1 functions as a ceRNA for miR-151a-3p, leading to the disinhibition of its endogenous target, X-ray repair cross complementing 4 (XRCC4), which enhances DSB repair in GBM cells. Exosomes selected from temozolomide-resistant GBM cells had high levels of SBF2-AS1 and spread TMZ resistance to chemoresponsive GBM cells.
References
Ref 1 Exosomal transfer of long non-coding RNA SBF2-AS1 enhances chemoresistance to temozolomide in glioblastoma. J Exp Clin Cancer Res. 2019 Apr 16;38(1):166. doi: 10.1186/s13046-019-1139-6.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.