Molecule Information
General Information of the Molecule (ID: Mol01638)
| Name |
hsa-miR-151a-3p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 151a
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
CUAGACUGAAGCUCCUUGAGG
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioblastoma [ICD-11: 2A00.02] | [1] | |||
| Resistant Disease | Glioblastoma [ICD-11: 2A00.02] | |||
| Resistant Drug | Temozolomide | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | DNA damage repair signaling pathway | Activation | hsa03410 | |
| miR151a-3p/XRCC4 signaling pathway | Regulation | N.A. | ||
| In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
| LN229 cells | Brain | Homo sapiens (Human) | CVCL_0393 | |
| A172 cells | Brain | Homo sapiens (Human) | CVCL_0131 | |
| T98 cells | Brain | Homo sapiens (Human) | CVCL_B368 | |
| U87 cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
| In Vivo Model | Subcutaneous and orthotopic xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RIP experiments; qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | Exosomal SBF2-AS1 functions as a ceRNA for miR-151a-3p, leading to the disinhibition of its endogenous target, X-ray repair cross complementing 4 (XRCC4), which enhances DSB repair in GBM cells. Exosomes selected from temozolomide-resistant GBM cells had high levels of SBF2-AS1 and spread TMZ resistance to chemoresponsive GBM cells. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
