Molecule Information

General Information of the Molecule (ID: Mol01638)

• Name: hsa-miR-151a-3p ,Homo sapiens
• Synonyms: microRNA 151a
• Molecule Type: Mature miRNA
• Sequence: CUAGACUGAAGCUCCUUGAGG
• Ensembl ID: ENSG00000254324
• HGNC ID: HGNC:31762
• Mature Accession: MIMAT0000757

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Temozolomide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Glioblastoma [1]

• Resistant Disease: Glioblastoma [ICD-11: 2A00.02]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: DNA damage repair signaling pathway; Activation; hsa03410
• Cell Pathway Regulation: miR151a-3p/XRCC4 signaling pathway; Regulation; hsa05206
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: LN229 cells; Brain; Homo sapiens (Human); CVCL_0393
• In Vitro Model: A172 cells; Brain; Homo sapiens (Human); CVCL_0131
• In Vitro Model: T98 cells; Brain; Homo sapiens (Human); CVCL_B368
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• In Vivo Model: Subcutaneous and orthotopic xenograft model; Mus musculus
• Experiment for Molecule Alteration: RIP experiments; qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: Exosomal SBF2-AS1 functions as a ceRNA for miR-151a-3p, leading to the disinhibition of its endogenous target, X-ray repair cross complementing 4 (XRCC4), which enhances DSB repair in GBM cells. Exosomes selected from temozolomide-resistant GBM cells had high levels of SBF2-AS1 and spread TMZ resistance to chemoresponsive GBM cells.

References

• Ref 1: Exosomal transfer of long non-coding RNA SBF2-AS1 enhances chemoresistance to temozolomide in glioblastoma. J Exp Clin Cancer Res. 2019 Apr 16;38(1):166. doi: 10.1186/s13046-019-1139-6.