Molecule Information

General Information of the Molecule (ID: Mol01634)

• Name: hsa-miR-383-5p ,Homo sapiens
• Synonyms: microRNA 383
• Molecule Type: Mature miRNA
• Sequence: AGAUCAGAAGGUGAUUGUGGCU
• Ensembl ID: ENSG00000199127
• HGNC ID: HGNC:31876
• Mature Accession: MIMAT0000738

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Regulation; hsa04151
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• In Vitro Model: CAOV3 cells; Ovary; Homo sapiens (Human); CVCL_0201
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Hoechst 33
• Mechanism Description: Up-regulation of miR-383-5p inhibited cell proliferation, tumor growth and enhanced chemosensitivity of ovarian cancer cells through suppressing TRIM27 expression.

References

• Ref 1: Up-regulation of miR-383-5p suppresses proliferation and enhances chemosensitivity in ovarian cancer cells by targeting TRIM27. Biomed Pharmacother. 2019 Jan;109:595-601. doi: 10.1016/j.biopha.2018.10.148. Epub 2018 Nov 3.