Molecule Information

General Information of the Molecule (ID: Mol01629)

• Name: hsa-miR-369-3p ,Homo sapiens
• Synonyms: microRNA 369
• Molecule Type: Mature miRNA
• Sequence: AAUAAUACAUGGUUGAUCUUU
• Ensembl ID: ENSG00000199025
• HGNC ID: HGNC:31783
• Mature Accession: MIMAT0000721

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: miR369-3p/SLC35F5 signaling pathway; Regulation; N.A.
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: Sk-MES-1 cells; Lung; Homo sapiens (Human); CVCL_0630
• In Vitro Model: 16HBE cells; Lung; Homo sapiens (Human); CVCL_0112
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Transwell invasion assay
• Mechanism Description: Attenuation of deregulated miR369-3p expression sensitizes non-small cell lung cancer cells to cisplatin via modulation of the nucleotide sugar transporter SLC35F5.

References

• Ref 1: Attenuation of deregulated miR-369-3p expression sensitizes non-small cell lung cancer cells to cisplatin via modulation of the nucleotide sugar transporter SLC35F5. Biochem Biophys Res Commun. 2017 Jul 1;488(3):501-508. doi: 10.1016/j.bbrc.2017.05.075. Epub 2017 May 13.