Molecule Information
General Information of the Molecule (ID: Mol01629)
Name |
hsa-miR-369-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 369
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
AAUAAUACAUGGUUGAUCUUU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [1] | |||
Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | miR369-3p/SLC35F5 signaling pathway | Regulation | hsa05206 | |
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
HEK293T cells | Kidney | Homo sapiens (Human) | CVCL_0063 | |
SPC-A1 cells | Lung | Homo sapiens (Human) | CVCL_6955 | |
H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
Sk-MES-1 cells | Lung | Homo sapiens (Human) | CVCL_0630 | |
16HBE cells | Lung | Homo sapiens (Human) | CVCL_0112 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Transwell invasion assay | |||
Mechanism Description | Attenuation of deregulated miR369-3p expression sensitizes non-small cell lung cancer cells to cisplatin via modulation of the nucleotide sugar transporter SLC35F5. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.