General Information of the Molecule (ID: Mol01628)
Name
hsa-miR-367-3p ,Homo sapiens
Synonyms
microRNA 367
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AAUUGCACUUUAGCAAUGGUGA
    Click to Show/Hide
Ensembl ID
ENSG00000199169
HGNC ID
HGNC:31781
Mature Accession
MIMAT0000719
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Sorafenib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [1]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Sorafenib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
MDM2/AR-FkBP5/PHLPP signaling pathway Regulation N.A.
AKT/ERK signaling pathway Regulation N.A.
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
SNU398 cells Liver Homo sapiens (Human) CVCL_0077
Skhep1 cells Liver Homo sapiens (Human) CVCL_0525
HA22T cells Liver Homo sapiens (Human) CVCL_7046
SNU423 cells Liver Homo sapiens (Human) CVCL_0366
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
3D Invasion Assay
Mechanism Description miR367-3p could increase AR expression via directly targeting the 3'UTR of MDM2 to decrease MDM2 protein expression. The resultant increase of AR expression might then promote the expression of FkBP5 and PHLPP, thus dephosphorylating and inactivating AkT and ERk, to suppress the HCC cell invasion. miR367-3p may function as an AR enhancer to increase Sorafenib chemotherapy efficacy via altering the MDM2/AR/FkBP5/PHLPP/(pAkT and pERk) signals to better suppress HCC metastasis.
References
Ref 1 The miR-367-3p Increases Sorafenib Chemotherapy Efficacy to Suppress Hepatocellular Carcinoma Metastasis through Altering the Androgen Receptor Signals. EBioMedicine. 2016 Oct;12:55-67. doi: 10.1016/j.ebiom.2016.07.013. Epub 2016 Jul 14.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.