Molecule Information
General Information of the Molecule (ID: Mol01623)
Name |
hsa-miR-29c-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 29c
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UAGCACCAUUUGAAAUCGGUUA
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Endometrial carcinoma | [1] | |||
Sensitive Disease | Endometrial carcinoma [ICD-11: 2C76.2] | |||
Sensitive Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell colony | Inhibition | hsa05200 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell viability | Inhibition | hsa05200 | ||
miR125a-5p/BCL2/MRP4 signaling pathway | Regulation | hsa05206 | ||
In Vitro Model | Ishikawa cells | Endometrium | Homo sapiens (Human) | CVCL_2529 |
HEC-1A cells | Uterus | Homo sapiens (Human) | CVCL_0293 | |
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | The up-regulation of miR-29c-3p using exogenous mimic molecules markedly increased PTX sensitivity in both cell lines and reduced expression of kDM5B while the inhibitor of miR-29-3p resulted in the opposite effects. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.