Molecule Information

General Information of the Molecule (ID: Mol01622)

• Name: hsa-miR-106b-5p ,Homo sapiens
• Synonyms: microRNA 106b
• Molecule Type: Mature miRNA
• Sequence: UAAAGUGCUGACAGUGCAGAU
• Ensembl ID: ENSG00000208036
• HGNC ID: HGNC:31495
• Mature Accession: MIMAT0000680

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Seminoma [1]

• Resistant Disease: Seminoma [ICD-11: 2C80.3]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: PI3K/AKT/mTOR signaling pathway; Regulation; hsa04151
• In Vitro Model: TCam-2 cells; Testicle; Homo sapiens (Human); CVCL_T012
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Long non-coding RNA H19 promotes TDRG1 expression and cisplatin resistance by sequestering miRNA-106b-5p in seminoma.

Disease Class: Seminoma [1]

• Resistant Disease: Seminoma [ICD-11: 2C80.3]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: PI3K/AKT/mTOR signaling pathway; Regulation; hsa04151
• In Vitro Model: TCam-2 cells; Testicle; Homo sapiens (Human); CVCL_T012
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Long non-coding RNA H19 promotes TDRG1 expression and cisplatin resistance by sequestering miRNA-106b-5p in seminoma.

Disease Class: Non-small cell lung cancer [2]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549/DDP cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis
• Mechanism Description: miR106b-5p enhanced the sensitivity of A549/DDP cells to cisplatin by targeting the expression of PkD2.

References

• Ref 1: Long non-coding RNA H19 promotes TDRG1 expression and cisplatin resistance by sequestering miRNA-106b-5p in seminoma. Cancer Med. 2018 Dec;7(12):6247-6257. doi: 10.1002/cam4.1871. Epub 2018 Nov 14.
• Ref 2: MicroRNA-106b-5p regulates cisplatin chemosensitivity by targeting polycystic kidney disease-2 in non-small-cell lung cancer. Anticancer Drugs. 2017 Sep;28(8):852-860. doi: 10.1097/CAD.0000000000000524.