Molecule Information

General Information of the Molecule (ID: Mol01622)

• Name: hsa-miR-106b-5p ,Homo sapiens
• Synonyms: microRNA 106b
• Molecule Type: Mature miRNA
• Sequence: UAAAGUGCUGACAGUGCAGAU
• Ensembl ID: ENSG00000208036
• HGNC ID: HGNC:31495
• Mature Accession: MIMAT0000680

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  MRAP: Metabolic Reprogramming via Altered Pathways

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Seminoma [ICD-11: 2C80.3] [1]

• Resistant Disease: Seminoma [ICD-11: 2C80.3]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: PI3K/AKT/mTOR signaling pathway; Regulation; N.A.
• In Vitro Model: TCam-2 cells; Testicle; Homo sapiens (Human); CVCL_T012
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Long non-coding RNA H19 promotes TDRG1 expression and cisplatin resistance by sequestering miRNA-106b-5p in seminoma.

Disease Class: Seminoma [ICD-11: 2C80.3] [1]

• Resistant Disease: Seminoma [ICD-11: 2C80.3]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: PI3K/AKT/mTOR signaling pathway; Regulation; N.A.
• In Vitro Model: TCam-2 cells; Testicle; Homo sapiens (Human); CVCL_T012
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Long non-coding RNA H19 promotes TDRG1 expression and cisplatin resistance by sequestering miRNA-106b-5p in seminoma.

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [2]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549/DDP cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis
• Mechanism Description: miR106b-5p enhanced the sensitivity of A549/DDP cells to cisplatin by targeting the expression of PkD2.

Metabolic Reprogramming via Altered Pathways (MRAP)

Disease Class: Oesophagus adenocarcinoma [ICD-11: 2B70.0] [3]

• Metabolic Type: Glutamine metabolism
• Resistant Disease: Oesophagus adenocarcinoma [ICD-11: 2B70.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Het-1A cells; Esophagus; Homo sapiens (Human); CVCL_3702
• In Vitro Model: KYSE-30 cells; Esophagus; Homo sapiens (Human); CVCL_1351
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Cell proliferation assay
• Mechanism Description: The results revealed that miR?106b?3p levels were upregulated, whereas TMG3 levels were downregulated in ESCC tissues. Dual?luciferase reporter assays confirmed that miR?106b?3p negatively regulated TGM3 expression by binding to its 3'UTR sequence. It was also shown that inhibition of miR?106b?3p could enhance the anti?proliferative effects, while promoting the apoptotic effects of cisplatin in the KYSE30 cell line by targeting TGM3. In conclusion, the present study demonstrated that downregulation of miR?106b?3p may increase the sensitivity of KYSE30 cell to cisplatin by targeting TGM3.

References

• Ref 1: Long non-coding RNA H19 promotes TDRG1 expression and cisplatin resistance by sequestering miRNA-106b-5p in seminoma. Cancer Med. 2018 Dec;7(12):6247-6257. doi: 10.1002/cam4.1871. Epub 2018 Nov 14.
• Ref 2: MicroRNA-106b-5p regulates cisplatin chemosensitivity by targeting polycystic kidney disease-2 in non-small-cell lung cancer. Anticancer Drugs. 2017 Sep;28(8):852-860. doi: 10.1097/CAD.0000000000000524.
• Ref 3: Downregulation of miR?106b?3p increases sensitivity to cisplatin in esophageal cancer cells by targeting TGM3. Mol Med Rep. 2021 Jun;23(6):471.