Molecule Information

General Information of the Molecule (ID: Mol01621)

• Name: hsa-miR-155-5p ,Homo sapiens
• Synonyms: microRNA 155
• Molecule Type: Mature miRNA
• Sequence: UUAAUGCUAAUCGUGAUAGGGGUU
• Ensembl ID: ENSG00000283904
• HGNC ID: HGNC:31542
• Mature Accession: MIMAT0000646

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: C13K cells are cisplatin-resistant variant originating from its cisplatin-sensitive OV2008 parental cells. We used miRNA microarray to determine miRNA expression profiles in both C13K and OV2008 cell lines. We have identified 113 miRNAs that were significantly differentially expressed in C13K cells, including 32 upregulated miRNAs (such as hsa-miR-205-5p, hsa-miR-200c-3p, hsa-miR-100-5p, hsa-miR-155-5p, and hsa-miR-125b-5p) and 81 down-regulated miRNAs (such as hsa-miR-214-3p, hsa-miR-199a-3p, hsa-miR-199b-3p, hsa-miR-199a-5p), compared to OV2008 cells.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Exosomal delivery of miR 155 5p may induce EMT and chemoresistant phenotypes from paclitaxel resistant gastric cancer cells to the sensitive cells, which may be mediated by GATA3 and TP53INP1 suppression.

Clinical Trial Drug(s) 1 drug(s) in total

PLX4720

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Papillary thyroid carcinoma [ICD-11: 2D10.1] [3]

• Resistant Disease: Papillary thyroid carcinoma [ICD-11: 2D10.1]
• Resistant Drug: PLX4720
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: Immunoblot analysis; qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: This gene is up-regulated in PLX4720-resistance cells

References

• Ref 1: Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.
• Ref 2: Paclitaxel resistant gastric cancer MGC 803 cells promote epithelial to mesenchymal transition and chemoresistance in paclitaxel sensitive cells via exosomal delivery of miR 155 5p. Int J Oncol. 2019 Jan;54(1):326-338. doi: 10.3892/ijo.2018.4601. Epub 2018 Oct 22.
• Ref 3: Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.