Molecule Information
General Information of the Molecule (ID: Mol01621)
Name |
hsa-miR-155-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 155
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UUAAUGCUAAUCGUGAUAGGGGUU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [1] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
In Vitro Model | MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Exosomal delivery of miR 155 5p may induce EMT and chemoresistant phenotypes from paclitaxel resistant gastric cancer cells to the sensitive cells, which may be mediated by GATA3 and TP53INP1 suppression. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.