General Information of the Molecule (ID: Mol01615)
Name
hsa-miR-185-5p ,Homo sapiens
Synonyms
microRNA 185
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGGAGAGAAAGGCAGUUCCUGA
    Click to Show/Hide
Ensembl ID
ENSG00000208023
HGNC ID
HGNC:31556
Mature Accession
MIMAT0000455
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
A549/DDP cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; TUNEL assay
Mechanism Description miR185-5p exhibited negative correlation with ABCC1 in A549/DDP cells., inhibition of miR185-5p was involved in chemo-resistance of NSCLC cells to cisplatin via down-regulating ABCC1.
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
PLX4720
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Papillary thyroid carcinoma [ICD-11: 2D10.1] [2]
Resistant Disease Papillary thyroid carcinoma [ICD-11: 2D10.1]
Resistant Drug PLX4720
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Experiment for
Molecule Alteration
Immunoblot analysis; qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description This gene is down-regulated in PLX4720-resistance cells
References
Ref 1 MicroRNA-185-5p modulates chemosensitivity of human non-small cell lung cancer to cisplatin via targeting ABCC1. Eur Rev Med Pharmacol Sci. 2016 Nov;20(22):4697-4704.
Ref 2 Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.