Molecule Information

General Information of the Molecule (ID: Mol01615)

• Name: hsa-miR-185-5p ,Homo sapiens
• Synonyms: microRNA 185
• Molecule Type: Mature miRNA
• Sequence: UGGAGAGAAAGGCAGUUCCUGA
• Ensembl ID: ENSG00000208023
• HGNC ID: HGNC:31556
• Mature Accession: MIMAT0000455

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549/DDP cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; TUNEL assay
• Mechanism Description: miR185-5p exhibited negative correlation with ABCC1 in A549/DDP cells., inhibition of miR185-5p was involved in chemo-resistance of NSCLC cells to cisplatin via down-regulating ABCC1.

References

• Ref 1: MicroRNA-185-5p modulates chemosensitivity of human non-small cell lung cancer to cisplatin via targeting ABCC1. Eur Rev Med Pharmacol Sci. 2016 Nov;20(22):4697-4704.