Molecule Information

General Information of the Molecule (ID: Mol01613)

• Name: hsa-miR-149-5p ,Homo sapiens
• Synonyms: microRNA 149
• Molecule Type: Mature miRNA
• Sequence: UCUGGCUCCGUGUCUUCACUCCC
• Ensembl ID: ENSG00000207611
• HGNC ID: HGNC:31536
• Mature Accession: MIMAT0000450

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Hippo signaling pathway; Inhibition; hsa04390
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• In Vitro Model: HO8910 cells; Ovary; Homo sapiens (Human); CVCL_6868
• In Vitro Model: CAOV3 cells; Ovary; Homo sapiens (Human); CVCL_0201
• In Vitro Model: ES-2 cells; Ovary; Homo sapiens (Human); CVCL_3509
• In Vitro Model: TOV-21G cells; Ovary; Homo sapiens (Human); CVCL_3613
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: miR-149-5p promotes the chemoresistance of ovarian cancer cells by directly targeting MST1 and SAV1, leading to the inactivation of Hippo signaling.

References

• Ref 1: miR 149 5p promotes chemotherapeutic resistance in ovarian cancer via the inactivation of the Hippo signaling pathway. Int J Oncol. 2018 Mar;52(3):815-827. doi: 10.3892/ijo.2018.4252. Epub 2018 Jan 24.