General Information of the Molecule (ID: Mol01613)
Name
hsa-miR-149-5p ,Homo sapiens
Synonyms
microRNA 149
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UCUGGCUCCGUGUCUUCACUCCC
    Click to Show/Hide
Ensembl ID
ENSG00000207611
HGNC ID
HGNC:31536
Mature Accession
MIMAT0000450
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Hippo signaling pathway Inhibition hsa04390
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
HO8910 cells Ovary Homo sapiens (Human) CVCL_6868
CAOV3 cells Ovary Homo sapiens (Human) CVCL_0201
ES-2 cells Ovary Homo sapiens (Human) CVCL_3509
TOV-21G cells Ovary Homo sapiens (Human) CVCL_3613
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description miR-149-5p promotes the chemoresistance of ovarian cancer cells by directly targeting MST1 and SAV1, leading to the inactivation of Hippo signaling.
References
Ref 1 miR 149 5p promotes chemotherapeutic resistance in ovarian cancer via the inactivation of the Hippo signaling pathway. Int J Oncol. 2018 Mar;52(3):815-827. doi: 10.3892/ijo.2018.4252. Epub 2018 Jan 24.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.