Molecule Information
General Information of the Molecule (ID: Mol01613)
Name |
hsa-miR-149-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 149
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UCUGGCUCCGUGUCUUCACUCCC
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Ovarian cancer | [1] | |||
Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Hippo signaling pathway | Inhibition | hsa04390 | ||
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
OVCAR3 cells | Ovary | Homo sapiens (Human) | CVCL_0465 | |
HO8910 cells | Ovary | Homo sapiens (Human) | CVCL_6868 | |
CAOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0201 | |
ES-2 cells | Ovary | Homo sapiens (Human) | CVCL_3509 | |
TOV-21G cells | Ovary | Homo sapiens (Human) | CVCL_3613 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | miR-149-5p promotes the chemoresistance of ovarian cancer cells by directly targeting MST1 and SAV1, leading to the inactivation of Hippo signaling. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.