Molecule Information

General Information of the Molecule (ID: Mol01609)

Name	hsa-miR-126-3p ,Homo sapiens
Synonyms	microRNA 126 Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	UCGUACCGUGAGUAAUAAUGCG Click to Show/Hide
Ensembl ID	ENSG00000199161
HGNC ID	HGNC:31508
Mature Accession	MIMAT0000445
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Dabrafenib

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Regulation by the Disease Microenvironment (RTDM)			Click to Show/Hide
Disease Class: Melanoma [ICD-11: 2C30.0]				[1]
Resistant Disease	Melanoma [ICD-11: 2C30.0]			Disease Info
Resistant Drug	Dabrafenib			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell invasion		Activation	hsa05200
	Cell migration		Activation	hsa04670
	Cell proliferation		Activation	hsa05200
In Vitro Model	A375 cells	Skin	Homo sapiens (Human)	CVCL_0132
	Sk-Mel28 cells	Skin	Homo sapiens (Human)	CVCL_0526
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTT assay; Flow cytometry assay
Mechanism Description	miR-126-3p down-regulation contributes to dabrafenib acquired resistance in melanoma by up-regulating ADAM9 and VEGF-A.

Temozolomide

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Glioblastoma [ICD-11: 2A00.02]				[2]
Sensitive Disease	Glioblastoma [ICD-11: 2A00.02]			Disease Info
Sensitive Drug	Temozolomide			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell autophagy		Inhibition	hsa04140
	Wnt/Beta-catenin signaling pathway		Activation	hsa04310
In Vitro Model	U251 cells	Brain	Homo sapiens (Human)	CVCL_0021
	U87 cells	Brain	Homo sapiens (Human)	CVCL_0022
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay; Colony formation assay; Flow cytometry assay
Mechanism Description	miR-126-3p sensitizes glioblastoma cells to temozolomide by inactivating Wnt/beta-catenin signaling via targeting SOX2.

References

Ref 1	miR-126-3p down-regulation contributes to dabrafenib acquired resistance in melanoma by up-regulating ADAM9 and VEGF-A. J Exp Clin Cancer Res. 2019 Jun 21;38(1):272. doi: 10.1186/s13046-019-1238-4.
Ref 2	miR-126-3p sensitizes glioblastoma cells to temozolomide by inactivating Wnt/Beta-catenin signaling via targeting SOX2. Life Sci. 2019 Jun 1;226:98-106. doi: 10.1016/j.lfs.2019.04.023. Epub 2019 Apr 10.