Molecule Information
General Information of the Molecule (ID: Mol01609)
Name |
hsa-miR-126-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 126
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UCGUACCGUGAGUAAUAAUGCG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Melanoma | [1] | |||
Resistant Disease | Melanoma [ICD-11: 2C30.0] | |||
Resistant Drug | Dabrafenib | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell invasion | Activation | hsa05200 | ||
Cell migration | Activation | hsa04670 | ||
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | A375 cells | Skin | Homo sapiens (Human) | CVCL_0132 |
Sk-Mel28 cells | Skin | Homo sapiens (Human) | CVCL_0526 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | miR-126-3p down-regulation contributes to dabrafenib acquired resistance in melanoma by up-regulating ADAM9 and VEGF-A. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Glioblastoma | [2] | |||
Sensitive Disease | Glioblastoma [ICD-11: 2A00.02] | |||
Sensitive Drug | Temozolomide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell autophagy | Inhibition | hsa04140 | ||
Wnt/Beta-catenin signaling pathway | Activation | hsa04310 | ||
In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
U87 cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Colony formation assay; Flow cytometry assay | |||
Mechanism Description | miR-126-3p sensitizes glioblastoma cells to temozolomide by inactivating Wnt/beta-catenin signaling via targeting SOX2. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.