Molecule Information
      General Information of the Molecule (ID: Mol01609)
  
  | Name | hsa-miR-126-3p
                                ,Homo sapiens
                               | ||||
|---|---|---|---|---|---|
| Synonyms | microRNA 126     Click to Show/Hide | ||||
| Molecule Type | Mature miRNA | ||||
| Sequence | UCGUACCGUGAGUAAUAAUGCG     Click to Show/Hide | ||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
      Type(s) of Resistant Mechanism of This Molecule
  
  
      Drug Resistance Data Categorized by Drug
  
  Approved Drug(s)
      2 drug(s) in total
      
    | Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|  | ||||
| Disease Class: Melanoma | [1] | |||
| Resistant Disease | Melanoma [ICD-11: 2C30.0] | |||
| Resistant Drug | Dabrafenib | |||
| Molecule Alteration | Expression | Down-regulation | ||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell invasion | Activation | hsa05200 | ||
| Cell migration | Activation | hsa04670 | ||
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | A375 cells | Skin | Homo sapiens (Human) | CVCL_0132 | 
| Sk-Mel28 cells | Skin | Homo sapiens (Human) | CVCL_0526 | |
| Experiment for Molecule Alteration | qRT-PCR | |||
| Experiment for Drug Resistance | MTT assay; Flow cytometry assay | |||
| Mechanism Description | miR-126-3p down-regulation contributes to dabrafenib acquired resistance in melanoma by up-regulating ADAM9 and VEGF-A. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|  | ||||
| Disease Class: Glioblastoma | [2] | |||
| Sensitive Disease | Glioblastoma [ICD-11: 2A00.02] | |||
| Sensitive Drug | Temozolomide | |||
| Molecule Alteration | Expression | Up-regulation | ||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell autophagy | Inhibition | hsa04140 | ||
| Wnt/Beta-catenin signaling pathway | Activation | hsa04310 | ||
| In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 | 
| U87 cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
| Experiment for Molecule Alteration | qRT-PCR | |||
| Experiment for Drug Resistance | CCK8 assay; Colony formation assay; Flow cytometry assay | |||
| Mechanism Description | miR-126-3p sensitizes glioblastoma cells to temozolomide by inactivating Wnt/beta-catenin signaling via targeting SOX2. | |||
      References
  
  visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.
