Molecule Information
General Information of the Molecule (ID: Mol01607)
| Name |
hsa-miR-125a-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 125a
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UCCCUGAGACCCUUUAACCUGUGA
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.0] | [1] | |||
| Resistant Disease | Esophageal squamous cell carcinoma [ICD-11: 2B70.0] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | OE19 cells | Esophagus | Homo sapiens (Human) | CVCL_1622 |
| kYSE410 cells | Esophagus | Homo sapiens (Human) | CVCL_1352 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Mechanism Description | Chemotherapy resistant sublines were found to have specific miRNA signatures, and these miRNA signatures were different for the cisplatin vs 5-FU resistant cells from the same tumor cell line, and also for EAC vs ESCC cells with resistance to the same specific chemotherapy agent. Amongst others, miR-27b-3p, miR-193b-3p, miR-192-5p, miR-378 a-3p, miR-125a-5p and miR-18a-3p were dysregulated, consistent with negative posttranscriptional control of KRAS, TYMS, ABCC3, CBL-B and ERBB2 expression via these miRNAs. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [2] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell colony | Inhibition | hsa05200 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | HEK293T cells | Kidney | Homo sapiens (Human) | CVCL_0063 |
| MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 | |
| SAOS-2 cells | Bone marrow | Homo sapiens (Human) | CVCL_0548 | |
| U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | ANRIL-silenced cells were more sensitive to cisplatin and the expression level of miR-125a-5p was elevated in ANRIL-silenced cells. | |||
| Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | [3] | |||
| Sensitive Disease | Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| STAT3 signaling pathway | Inhibition | hsa04550 | ||
| In Vitro Model | ECA-109 cells | Esophagus | Homo sapiens (Human) | CVCL_6898 |
| TE-1 cells | Esophagus | Homo sapiens (Human) | CVCL_1759 | |
| EC9706 cells | Esophagus | Homo sapiens (Human) | CVCL_E307 | |
| EC1 cells | Esophagus | Homo sapiens (Human) | CVCL_DC74 | |
| KYSE70 cells | Esophagus | Homo sapiens (Human) | CVCL_1356 | |
| kYSE450 cells | Esophagus | Homo sapiens (Human) | CVCL_1353 | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay; Would healing assay; Invasion assay | |||
| Mechanism Description | miR 125a 5p and cisplatin markedly inactivated the STAT3 signaling pathway. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.0] | [4] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.0] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | MAPK signalling pathway | Regulation | N.A. | |
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| Experiment for Molecule Alteration |
MiRNA microarray analyses, qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | In this study, mRNA and miRNA expression profiling of the drug resistant sublines, SGC7901/VCR and SGC7901/ADR, and their parental gastric cancer cell line SGC7901 were performed. A significant number of genes and a limited subset of miRNAs were commonly dysregulated, which were further validated using qRT-PCR. GO and KEGG pathway analyses of the commonly dysregulated genes indicated that the MAPK signalling pathway may be involved in multidrug resistance, which was further validated using immunoblotting and MTT assay. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastrointestinal stromal tumor [ICD-11: 2B5B.0] | [5] | |||
| Resistant Disease | Gastrointestinal stromal tumor [ICD-11: 2B5B.0] | |||
| Resistant Drug | Imatinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
| Cell migration | Activation | hsa04670 | ||
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | GIST882 cells | Gastric | Homo sapiens (Human) | CVCL_7044 |
| GIST48 cells | Gastric | Homo sapiens (Human) | CVCL_7041 | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
WST-1 assay | |||
| Mechanism Description | miR-125a-5p expression modulated imatinib sensitivity in GIST882 cells with a homozygous kIT mutation but not in GIST48 cells with double kIT mutations. Overexpression of miR-125a-5p suppressed PTPN18 expression, and silencing of PTPN18 expression increased cell viability in GIST882 cells upon imatinib treatment. PTPN18 protein levels were significantly lower in the imatinib-resistant GISTs and inversely correlated with miR-125a-5p. Furthermore, several microRNAs were significantly associated with metastasis, kIT mutational status and survival. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.0] | [4] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.0] | |||
| Resistant Drug | Vincristine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | MAPK signalling pathway | Regulation | N.A. | |
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| Experiment for Molecule Alteration |
MiRNA microarray analyses, qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | In this study, mRNA and miRNA expression profiling of the drug resistant sublines, SGC7901/VCR and SGC7901/ADR, and their parental gastric cancer cell line SGC7901 were performed. A significant number of genes and a limited subset of miRNAs were commonly dysregulated, which were further validated using qRT-PCR. GO and KEGG pathway analyses of the commonly dysregulated genes indicated that the MAPK signalling pathway may be involved in multidrug resistance, which was further validated using immunoblotting and MTT assay. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
