Molecule Information
General Information of the Molecule (ID: Mol01591)
Name |
hsa-miR-224-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 224
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UCAAGUCACUAGUGGUUCCGUUUAG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Ovarian papillary serous carcinoma | [1] | |||
Resistant Disease | Ovarian papillary serous carcinoma [ICD-11: 2C73.4] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
PRKCD signaling pathway | Inhibition | hsa05208 | ||
In Vitro Model | A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 |
OV2008 cells | Ovary | Homo sapiens (Human) | CVCL_0473 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTS assay; TUNEL assay | |||
Mechanism Description | PRkCD, known as protein kinase C deta, is a PkC isozyme that acts as a substrate for caspase-3. Its activity is believed to be required for apoptosis induced by DNA damaging agents such as cisplatin, mitomycin C and doxorubicin. miR-224-5p could negatively regulate the expression of PRkCD, and together with PRkCD, they can serve as novel predictors and prognostic biomarkers for OPSC patient response to overall disease-specific survival. The PRkCD pathway may be a molecular mechanism through which miR-224-5p exerts its functions as an oncogene and enhancer of chemoresistance to cisplatin in OPSC patients. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.