Molecule Information

General Information of the Molecule (ID: Mol01591)

• Name: hsa-miR-224-5p ,Homo sapiens
• Synonyms: microRNA 224
• Molecule Type: Mature miRNA
• Sequence: UCAAGUCACUAGUGGUUCCGUUUAG
• Ensembl ID: ENSG00000284363
• HGNC ID: HGNC:31604
• Mature Accession: MIMAT0000281

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian papillary serous carcinoma [1]

• Resistant Disease: Ovarian papillary serous carcinoma [ICD-11: 2C73.4]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: PRKCD signaling pathway; Inhibition; hsa05208
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: OV2008 cells; Ovary; Homo sapiens (Human); CVCL_0473
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay; TUNEL assay
• Mechanism Description: PRkCD, known as protein kinase C deta, is a PkC isozyme that acts as a substrate for caspase-3. Its activity is believed to be required for apoptosis induced by DNA damaging agents such as cisplatin, mitomycin C and doxorubicin. miR-224-5p could negatively regulate the expression of PRkCD, and together with PRkCD, they can serve as novel predictors and prognostic biomarkers for OPSC patient response to overall disease-specific survival. The PRkCD pathway may be a molecular mechanism through which miR-224-5p exerts its functions as an oncogene and enhancer of chemoresistance to cisplatin in OPSC patients.

References

• Ref 1: Expression of miR-224-5p is associated with the original cisplatin resistance of ovarian papillary serous carcinoma. Oncol Rep. 2014 Sep;32(3):1003-12. doi: 10.3892/or.2014.3311. Epub 2014 Jul 7.