Molecule Information
General Information of the Molecule (ID: Mol01591)
| Name |
hsa-miR-224-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 224
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UCAAGUCACUAGUGGUUCCGUUUAG
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian papillary serous carcinoma [ICD-11: 2C73.4] | [1] | |||
| Resistant Disease | Ovarian papillary serous carcinoma [ICD-11: 2C73.4] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| PRKCD signaling pathway | Inhibition | hsa05208 | ||
| In Vitro Model | A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 |
| OV2008 cells | Ovary | Homo sapiens (Human) | CVCL_0473 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay; TUNEL assay | |||
| Mechanism Description | PRkCD, known as protein kinase C deta, is a PkC isozyme that acts as a substrate for caspase-3. Its activity is believed to be required for apoptosis induced by DNA damaging agents such as cisplatin, mitomycin C and doxorubicin. miR-224-5p could negatively regulate the expression of PRkCD, and together with PRkCD, they can serve as novel predictors and prognostic biomarkers for OPSC patient response to overall disease-specific survival. The PRkCD pathway may be a molecular mechanism through which miR-224-5p exerts its functions as an oncogene and enhancer of chemoresistance to cisplatin in OPSC patients. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
