Molecule Information

General Information of the Molecule (ID: Mol01585)

Name	hsa-miR-214-3p ,Homo sapiens
Synonyms	microRNA 214 Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	ACAGCAGGCACAGACAGGCAGU Click to Show/Hide
Ensembl ID	ENSG00000283844
HGNC ID	HGNC:31591
Mature Accession	MIMAT0000271
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

1 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Pediatric intracranial nongerminomatous malignant germ cell tumors				[1]
Resistant Disease	Pediatric intracranial nongerminomatous malignant germ cell tumors [ICD-11: 2A00.07]			Disease Info
Resistant Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	293T cells	Breast	Homo sapiens (Human)	CVCL_0063
Experiment for Molecule Alteration	RT-qPCR
Experiment for Drug Resistance	MTT Assay
Mechanism Description	miR214-3p overexpression enhanced cisplatin resistance by downregulating the expression of its target, the apoptotic protein BCL2-like 11 (BCL2L11/BIM).

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Epithelial ovarian cancer				[2]
Sensitive Disease	Epithelial ovarian cancer [ICD-11: 2B5D.0]			Disease Info
Sensitive Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell invasion		Inhibition	hsa05200
	Cell proliferation		Inhibition	hsa05200
In Vitro Model	OVCAR3 cells	Ovary	Homo sapiens (Human)	CVCL_0465
	CAOV3 cells	Ovary	Homo sapiens (Human)	CVCL_0201
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	qRT-PCR; Luciferase reporter assay
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	Upregulation of long non-coding RNA XIST has anticancer effects on epithelial ovarian cancer cells through inverse downregulation of hsa-miR-214-3p.

References

Ref 1	Global DNA methylation analysis reveals miR-214-3p contributes to cisplatin resistance in pediatric intracranial nongerminomatous malignant germ cell tumors. Neuro Oncol. 2018 Mar 27;20(4):519-530. doi: 10.1093/neuonc/nox186.
Ref 2	Upregulation of long non-coding RNA XIST has anticancer effects on epithelial ovarian cancer cells through inverse downregulation of hsa-miR-214-3p. J Gynecol Oncol. 2018 Nov;29(6):e99. doi: 10.3802/jgo.2018.29.e99.