Molecule Information
General Information of the Molecule (ID: Mol01585)
Name |
hsa-miR-214-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 214
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
ACAGCAGGCACAGACAGGCAGU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Pediatric intracranial nongerminomatous malignant germ cell tumors | [1] | |||
Resistant Disease | Pediatric intracranial nongerminomatous malignant germ cell tumors [ICD-11: 2A00.07] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | 293T cells | Breast | Homo sapiens (Human) | CVCL_0063 |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT Assay | |||
Mechanism Description | miR214-3p overexpression enhanced cisplatin resistance by downregulating the expression of its target, the apoptotic protein BCL2-like 11 (BCL2L11/BIM). |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Epithelial ovarian cancer | [2] | |||
Sensitive Disease | Epithelial ovarian cancer [ICD-11: 2B5D.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | OVCAR3 cells | Ovary | Homo sapiens (Human) | CVCL_0465 |
CAOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0201 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR; Luciferase reporter assay | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Upregulation of long non-coding RNA XIST has anticancer effects on epithelial ovarian cancer cells through inverse downregulation of hsa-miR-214-3p. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.