General Information of the Molecule (ID: Mol01584)
Name
hsa-miR-211-5p ,Homo sapiens
Synonyms
microRNA 211
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UUCCCUUUGUCAUCCUUCGCCU
    Click to Show/Hide
Ensembl ID
ENSG00000207702
HGNC ID
HGNC:31588
Mature Accession
MIMAT0000268
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Vemurafenib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Melanoma [ICD-11: 2C30.0] [1]
Resistant Disease Melanoma [ICD-11: 2C30.0]
Resistant Drug Vemurafenib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation ERK1/2/MEK activation signaling pathway|hsa04210) Regulation N.A.
MAPK signaling pathway Activation hsa04010
PI3K signaling pathway Activation hsa04151
RAS signaling pathway Activation hsa04014
In Vitro Model A375 cells Skin Homo sapiens (Human) CVCL_0132
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR204-5p and miR211-5p contribute to BRAF inhibitor resistance in melanoma. MTT assays revealed a moderate but consistent increase in resistance to VMF in cells overexpressing miR211-5p or miR204-5p. Joint overexpression of miR204-5p and miR211-5p durably stimulated Ras and MAPk upregulation. Resistance to BRAFi in melanoma involves genetic alterations that lead to reactivation of the MAPk pathway or activation of PI3-k/AkT signalling.
References
Ref 1 miR-204-5p and miR-211-5p Contribute to BRAF Inhibitor Resistance in Melanoma. Cancer Res. 2018 Feb 15;78(4):1017-1030. doi: 10.1158/0008-5472.CAN-17-1318. Epub 2017 Dec 11.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.