Molecule Information
General Information of the Molecule (ID: Mol01584)
Name |
hsa-miR-211-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 211
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UUCCCUUUGUCAUCCUUCGCCU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Melanoma | [1] | |||
Resistant Disease | Melanoma [ICD-11: 2C30.0] | |||
Resistant Drug | Vemurafenib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | ERK1/2/MEK activation signaling pathway|hsa04210) | Regulation | ||
MAPK signaling pathway | Activation | hsa04010 | ||
PI3K signaling pathway | Activation | hsa04151 | ||
RAS signaling pathway | Activation | hsa04014 | ||
In Vitro Model | A375 cells | Skin | Homo sapiens (Human) | CVCL_0132 |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR204-5p and miR211-5p contribute to BRAF inhibitor resistance in melanoma. MTT assays revealed a moderate but consistent increase in resistance to VMF in cells overexpressing miR211-5p or miR204-5p. Joint overexpression of miR204-5p and miR211-5p durably stimulated Ras and MAPk upregulation. Resistance to BRAFi in melanoma involves genetic alterations that lead to reactivation of the MAPk pathway or activation of PI3-k/AkT signalling. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.